Additional file 1 of Prenatal lipopolysaccharide exposure induces anxiety-like behaviour in male mouse offspring and aberrant glial differentiation of embryonic neural stem cells

Additional file 1: Approved Animal Protocol MMH-A-S-106-52

Binding of d(CCG)₈C to Arg-Trp-Arg-Trp-Lys-Leu-NH₂ as a function of [NaCl].

<p>A. Fluorescence titrations were performed as in Fig. 3, with the following [NaCl]: ▪, 0.01 M; ♦, 0.05 M; □, 0.075 M; ▴, 0.1 M. B. NaCl reversal: ▪, reversal of 0.01 M titration of Arg-Trp-Arg-Trp-Lys-Leu-NH₂ with d(CCG)₈C_; ◯, reversal of 0.01 titration of crotamine with d(CCG)₈C (data from Fig. 3B).</p

DNA length, concentration, and salt dependencies of crotamine-DNA aggregations, in the standard buffer, unless otherwise indicated.

<p>A. Effect of DNA length. Lane 1: DNA ladder; lane 2∶1 µg (3 nmol in residue) DNA ladder +0.3 nmol crotamine, [crotamine]:[DNA]_p = 1∶10; lane 3: same as lane 2, but treated with SDS (0.1% net) prior to electrophoresis; lane 4: supernatant of mixture as in lane 2 after centrifugation at 13,000 rpm for 5 min; lane 5: precipitate of mixture in lane 4 after treatment with 0.1% SDS. B. Effect of relative DNA concentration. Each lane contained 0.5 µg DNA ladder. Samples were centrifuged at 13,000 rpm for 5 min, and supernatants applied to the gel. Lane 1: DNA alone. [crotamine]:[DNA]_p = 1∶30 (lane 2), = 1∶20 (lane 3), = 1∶15 (lane 4), = 1∶12 (lane 5), = 1∶10 (lane 6), = 1∶7.5 (lane 7). C. Effect of salt. Each lane contained 1 µg DNA ladder. Lane 1: DNA ladder alone. Lanes 2–7∶0.5 µg DNA ladder +0.3 nmol crotamine in 0.01 M NaCl (lane 2: supernatant, lane 3: SDS-treated precipitate), in 0.05 M NaCl (lane 4: supernatant, lane 5: SDS-treated precipitate), in 0.1 M NaCl (lane 6: supernatant, lane 7: SDS-treated precipitate).</p

Scatchard plots and salt dependence of the data in Fig. 3.

<p>A. Scatchard plot: ν ≡ [crotamine]_bound/[total d(CCG)₈C]_p, L ≡ [crotamine]_free. The solid lines represent curves calculated from the best fit of the Tsodikov et al. <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0048913#pone.0048913-Tsodikov1" target="_blank">[35]</a> modification of the McGhee-von Hippel model for non-cooperative binding ligands <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0048913#pone.0048913-McGhee1" target="_blank">[34]</a> (see Materials and Methods). B. Log-log dependence of the association constants calculated in panel A on [Na⁺].</p

Binding of d(CCG)₈C to crotamine as a function of [NaCl].

<p>A. Fluorescence titrations were performed in the standard buffer (0.02 M Hepes, pH 7.5, 0.0001 M EDTA) with the following [NaCl]: ▪, 0.01 M; ♦, 0.05 M; □, 0.075 M; ▴, 0.1 M. B. Reversal of 0.01 M titration by addition of aliquots of a concentrated solution of NaCl. [Na+] was calculated from the [NaCl] and the contribution of the other components of the buffer. The lines connect the points and are shown for clarity.</p

Dependence of Crotamine - d(CCG)₈C Association Constants on [NaCl]^*.

*<p>Titrations were performed in 0.02 M Hepes, pH. 7.7, 0.0001 M Na₂EDTA, and the indicated concentration of NaCl. The [Na⁺] includes the contribution from the buffer (0.01 M).</p

Dependence of binding affinity on oligonucleotide sequence.

<p>A. Fluorescence titration in the standard buffer with 0.01 M NaCl: ◯, d(ATGTGGAAAATCTCTAGCAGT) (21+); ▴, d(ACTGCTAGAGATTTTCCACAT) (21-); ▪, duplex (21+/−). B. NaCl-induced reversal.</p

Spectrophotometry of crotamine-DNA mixtures in 0.02 M Hepes, pH 7.5, 0.01 M NaCl, 0.0001 M EDTA (standard buffer with indicated [NaCl]).

<p>A. Spectra of 4.1×10⁻⁵ M ds calf thymus DNA +4.3×10⁻⁶ M crotamine. ––––––, DNA alone; · · · · ·, crotamine alone; – – – –, DNA + crotamine prior to centrifuging; – · – · – · –, DNA + crotamine supernatant after centrifuging; – · · – · · – · · –, sum of individual DNA and crotamine spectra. B. Spectra of 2.5×10⁻⁵ M(p) 25-mer (CCG)₈C and 2.5×10⁻⁶ M crotamine. ––––––, DNA alone; · · · · ·, crotamine alone; – – – –, DNA + crotamine. C. Titration of ds calf thymus DNA with crotamine; starting [DNA] = 2.22×10⁻⁵ M(p). D. Titration of d(CCG)₈C with crotamine; starting [DNA] = 1.21×10⁻⁴ M(p). E. Titration of d(CCG)₈C•G(CGG)₈ with crotamine; starting [DNA] = 6.2×10⁻⁵ M(p).</p

Possible model for crotamine – double stranded DNA major groove interaction.

<p>Crotamine (1h50.pdb) and DNA (1bna.pdb) were generated using Rasmol. <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0048913#pone.0048913-Sayle1" target="_blank">[46]</a> Sidechains of potentially interacting arginine and tryptophan residues are indicated. The locations of the six lysine ε-NH₂ groups visible in the pictured orientation are indicated by circles.</p

Incidence of diabetic retinopathy and the hazard ratio for the retinitis pigmentosa and comparison groups.

<p>PY: person-years; CI: confidence interval; NPDR, nonproliferative diabetic retinopathy; PDR, proliferative diabetic retinopathy.</p>†<p>per 1000 person-years.</p>‡<p>adjusted for sex, age, residence area, hypertension, glaucoma, cataracts, and heart disease.</p