Development of a novel PCR based analytical protocol for the characterization of the two variants of prolactin gene that affect milk yield in sheep breeds

Prolactin is a lactogenic hormone which plays a significant role in milk production in mammals, and its depletion in sheep provokes severe reduction of milk secretion. Two different variants within intron 2 of the prolactin gene have been described (A and B) and this polymorphism has been recently proposed as a marker for future breeding schemes in dairy sheep. The present study fully characterized this polymorphism, resulting in a simpler and cost effective PCR-based assay for genetic identification in sheep populations. Up to now, the two variants A and B were identified by their difference in RFLP digestion patterns. This assay, however, is laborious since it requires the generation of a 2.5kb PCR fragment from genomic DNA prior to digestion, which is often difficult to obtain. By sequencing PCR products form AA and BB homozygous animals and performing alignments, we confirmed that the B variant results from a 23bp deletion (sequence: GGTGTTTCTCTTCATAAAGACTC) of the A variant of the prolactin gene. This finding assisted the design of new primers for the identification of prolactin polymorphism based on the size of the PCR product and relinquishes the need of RFLP digestions. Using these developments, we genotyped an experimental flock of 380 Chios breed sheep and carried out association studies. In contrast to other sheep breeds, such as the East Friesian and the Serra da Estela, our preliminary data showed no significant effect of this gene on Chios first lactation milk yield. However, the effects of the prolactin gene merit more investigation

Androgenic and oestrogenic effects on the endrocrinology of reproductive development in male and female sheep (Ovis aries L.) / by Christakis Papachristoforou.

Typescript."April 1987."Includes bibliograpical references (leaves 160-194).xii, 194 leaves : ill. ; 30 cm.Presents direct comparative information on growth and endocrinological aspects of reproductive development in intact and gonadectomized male and female Merino lambs born in autumn and treated prepubertally with either a non-aromatizable androgen (trenbolone acetate) with higher androgenic potency than testosterone, oestradiol -17beta(oestradiol), or a combination of these two steroid hormones.Thesis (Ph.D.)--University of Adelaide, Dept. of Animal Sciences, 198

Innovations Have Improved the Efficiency of Ruminant Production Systems in Cyprus

Substantial improvements in the efficiency of ruminant production systems in Cyprus resulting from technological and process innovations adopted by farmers have been realised over the last three decades. In the dairy cattle sector, the technological innovations introduced mainly concern mechanical and electronic systems to control the feeding, management and milking of cows. The expansion of artificial insemination has also contributed to the genetic improvement of the animals. All these have driven the national average milk yield from less than 4,800 kg in the mid 1980s, to about 6,300 kg today, while the average yield in recorded herds exceeds 7,000 kg. However, in 1990 there were 535 dairy herds, whereas today there are only 240. In the sheep/goat sector, the most important innovations relate to the adoption of early weaning, artificial rearing, fattening of lambs/kids, changes in the age at slaughter, along with better herd management methods, and the introduction of milking machines. Weaning age has been reduced to 5 weeks for lambs and 7 weeks for kids leading to increases in the quantity of milk sold; further increases have been obtained by artificial rearing of lambs/kids. Fattening from weaning to the slaughter age of 18-20 weeks, exploits the period of optimal efficiency for growth and produces good quality carcasses. The 'two matings per year' system adopted by many farmers is also beneficial, because it extends the marketing period of sheep/goat products. As a consequence of these changes, the sector has moved towards mediumhigh input systems and larger farm

Genetic and phenotypic relationships between milk production and body weight in Chios sheep and Damascus goats

Data on 2087 lactations from 737 Chios ewes collected between 1978 and 1989, and 1611 lactations from 486 Damascus goats collected from 1982 to 1998 at the experimental station of the Agricultural Research Institute were utilized. The ewes were the progeny of 101 sires (mean sire family size 7.3) and the goats of 101 sires (mean sire family size 4.8). A mixed linear model that accounted for the year and season of lambing/kidding and parity of ewes or goats (fixed effects) and sires within years (random effects) was used. Phenotypic and genetic variance and covariance estimates were obtained from paternal halp sib correlations. The study was conducted to investigate genetic and phenotypic relationships between milk production (90-day and total milk) and live weight at mating. Year effects were significant (P<0.01) for all traits studied, while season of parturition significantly affected (P<0.01) only milk production (part and total). Parity had a significant quadratic effect (P<0.01) on all traits examined; the highest response in milk production was reached in the third parity and the highest body weight at mating in the fifth parity. Heritability estimates for 90-day (0.44±0.08 and 0.45±0.11) and total milk yield (0.54±0.09 and 0.49±0.11) for sheep and goats, respectively, were high, indicating that genetic progress from direct selection on either trait would be effective. Heritability of body weight at mating, unadjusted or adjusted to mature equivalent, was high in both species (sheep: 0.79±0.09 and 0.76±0.09, respectively; goats: 0.79±0.11 and 0.80±0.11, respectively). Genetic and phenotypic correlations between part and total lactation yield were both high and positive, justifying selection on early measures of milk production. The genetic associations between production traits and body weight at mating were very low in both species. It was positive in sheep and negative in goats, but no or extremely small correlated responses could be expected in body weight from selection on milk production. Increased body size, when expressed, should be the consequence of better feeding and improved management practices during periods of stress

Seasonal effects on puberty and reproductive characteristics of female Chios sheep and Damascus goats born in autumn or in February

Ten Chios ewe lambs and 10 Damascus she-kids born in October–November and similar numbers born in February along with eight multiparous females from each species, were used to examine pubertal events and reproductive seasonality. Reproductive activity was monitored by determining serum progesterone concentrations once a week for 12 months. The mean date of onset of ovulation (puberty) in autumn-born Chios females (7 August) was earlier (p<0.05) than in February-born ones (11 September) though the onset of regular cyclicity was not significantly different between the two groups (30 August and 19 September, respectively). The age and live weight at puberty in autumn-born females was higher (p<0.01) than in February-born ones, the respective values being 43.3 weeks and 50.1 kg, versus 29.9 weeks and 42.0 kg. All animals, irrespective of time of birth, started ovulating after the summer equinox. Multiparous Chios ewes had reproductive cycles covering most time of the year with acyclic periods during spring and summer. In ewe lambs, about half of the animals ceased cycling during the second half of winter and in spring, while the rest continued cycling. The total number of cycles detected over the experimental period was lower (p<0.05) for February-born (n=9.4) compared with autumn-born females (n=13.7) and adult ewes (n=17.1). In Damascus she-kids born in autumn or in February, onset of puberty was at the same time in the following autumn, the respective mean date for the two groups being 1 November and 27 October. For autumn-born animals, age (48.4 weeks) and live weight (53.8 kg) at puberty were higher (p<0.01) than for those born in February (37.3 weeks, 42.9 kg). Reproductive cycles in adult goats started in the second half of September and continued until the end of March. Most young goats (75%) had their last seasonal cycle in February and the rest in March. The total number of cycles was higher (p<0.01) in adult (n=8.1) than in young goats born either in autumn (n=6.3) or in February (n=5.7). It is concluded that reproductive development and puberty in Chios female sheep are mostly under seasonal influences though age and body weight are also contributing factors. This breed has a long reproductive season with some animals cycling throughout the year. The Damascus female goat is strictly seasonal with distinct periods of reproductive cyclicity and inactivity. Puberty attainment of Damascus females born in autumn or in February is at the same time the following autumn

Effects of lasalocid on growth, nutrient digestibility and rumen characteristics in chios lambs and Damascus kids

Two feeding trials and one digestibility trial with early weaned Damascus kids (50 days of age) and one feeding trial with early weanes Chios female lambs (42 days of age) were carried out to investigate the effects of lasalocid sodium (37.5 mg kg−1 feed as fed basis) on growth and incidence of coccidiosis. In the first feeding trial with kids, the effect of protecting the feeding troughs from being contaminated with faeces was also examined. Both the protection of troughs and the addition of lasalocid sodium significantly improved growth of kids in the first trial. Feed utilization was also improved (11%) when a lasalocid containing diet was fed. Addition of lasalocid increased propionate and decreased butyrate relative molar proportions in the rumen. Differences in acetate molar proportion, ruminal pH, NH3-N concentration or total VFA between the diets were not significant. In the second trial, kids fed the lasalocid diet tended to grow faster. Feed efficiency was also improved (7.6%). In the third trial, lambs on the lasalocid containing diet grew faster, but there was no improvement in conversion efficiency. Digestion coefficients (determined with kids) of dry matter, organic matter and crude protein were 0.76, 0.77, 0.69 and 0.78, 0.79, 0.74 for the control and the diet containing lasalocid, respectively. Four clinical cases of coccidiosis were reported in kids fed the control diet (unprotected troughs, no lasalocid) in the first trial and three cases in the no lasalocid diet in the second trial. In the trial with lambs, no clinical case of coccidiosis was recorded

Analysis of PrP genotypes in relation to reproductive and production traits in Chios sheep

The study describes the changes with time in gene and genotype frequencies of a closed Chios herd. Genomic DNA was isolated and purified from peripheral blood leucocytes using standard procedures. The identification of the allelic variants present in the DNA samples, was performed in a simple multiplex PCR reaction and melting curve analysis of the PrP gene. Only ARR/ARR female genotypes were kept for breeding, and only males of the same genotype were used following year 2 of the study. As a result of planned individual matings and selection, the susceptible ARQ/ARQ genotype was eliminated from the flock in 4 years. The gene frequency of the R allele from a low 0.056 at year 1 reached a high 0.911 at year 6 of the study. Data from first lactation ewes of known genotypes were used to examine possible associations between PrP genotypes and ewe reproductive (litter size at birth and at weaning) and production traits (litter weight at birth and at weaning and 60-day milk yield after weaning). No effects of the sire genotype (ARR/ARR and ARR/ARQ) were found for any of the traits studied. The ewe genotype was associated with performance for reproductive traits but not with total weight of lamb output at birth or at weaning. ARR/ARR ewes had a higher litter size at birth (2.09) compared to ARQ/ARQ ewes (1.79) and higher litter size at weaning (1.84) compared to ARR/ARQ ewes (1.59). 60-day milk yield after weaning was not influenced by genotype (114.8, 105.8 and 114.8 kg for ARR/ARR, ARR/ARQ and ARQ/ARQ genotypes, respectively). Birth weight and 98-day weight were not influenced by the lamb genotype. ARQ/ARQ lambs were slightly heavier (P < 0.05) than ARR/ARR lambs at weaning as a result of faster pre-weaning growth. Post weaning growth was similar for the homozygous genotypes

Identification of established genetic variants associated with milk traits

The present study investigated the genetic diversity of small ruminant breeds of Cyprus, regarding β-lactoglobulin (β-LG) genotypes and the existence of bovine single nucleotide polymorphisms (SNPs). In total, 366 animals belonging to the Chios and Cyprus fat-tailed sheep breeds, and to the Damascus and Machaeras goat breeds, were genotyped for the identification of the most common β-lactoglobulin variants (A and B), as well as for the presence of the growth hormone receptor (GHR) F279Y and the acylCoA:diacylglycerol acyltransferase 1 (DGAT1) K232A SNPs. With regard to β-lactoglobulin genotypes, two genetic variants (A and B) were identified for the sheep breeds and only one variant (A) for the goat breeds. The results showed that variant B of β-LG gene was not present in any caprine sample and therefore a fixed A-allelic genotype was suggested for both goat breeds. However, the present study showed that the Cyprus fat-tailed sheep was predominantly of the β-LG B type demonstrating significant differences in allelic frequencies (P < 0.001) and genotypic distributions (P < 0.05) compared to Chios sheep, revealing unusually high distribution of the BB genotype (38.5% of the total genotypes) as compared to Chios (4.5%) or other Mediterranean sheep breeds. With regard to bovine SNPs, the present study investigated the existence of GHR F279Y and the DGAT1 K232A SNPs, which have both been previously well documented in cattle as having strong effects on milk yield and composition. Although we were able to confirm the presence of both of these mutations in bovine sample controls by both allele specific PCR reactions and direct DNA sequencing, we were unable to detect them in all four major pure breeds of sheep and goats supporting the small ruminant dairy industry in Cyprus