Development of a Real-time PCR test for porcine group A rotavirus diagnosis

Group A Rotavirus (RVA) is one of the most common causes of diarrhea in humans and several animal species. A SYBR-Green Real-Time polymerase chain reaction (PCR) was developed to diagnose RVA from porcine fecal samples, targeting amplification of a 137-bp fragment of nonstructural protein 5 (NSP5) gene using mRNA of bovine NADH-desidrogenase-5 as exogenous internal control. Sixty-five samples were tested (25 tested positive for conventional PCR and genetic sequencing). The overall agreement (kappa) was 0.843, indicating 'very good' concordance between tests, presenting 100% of relative sensitivity (25+ Real Time PCR/25+ Conventional PCR) and 87.5% of relative sensitivity (35- Real Time PCR/40- Conventional PCR). The results also demonstrated high intra- and inter-assay reproducibility (coefficient of variation ≤1.42%); thus, this method proved to be a fast and sensitive approach for the diagnosis of RVA in pigs

Three-dimensional optoacoustic monitoring of lesion formation in real time during radiofrequency catheter ablation.

INTRODUCTION: Due to lack of reliable imaging contrast from catheter radiofrequency ablation (RFA) lesions, the vast majority of current procedures rely on indirect indicators of ablation activity, resulting in a significant number of arrhythmia reoccurrences after RFA procedures and the need for repeat surgeries. The objective of this work is to develop an accurate method for on-the-fly assessment of the durability and size of lesions formed during RFA procedures. METHOD AND RESULTS: Radiofrequency catheter ablation on freshly-excised porcine ventricular myocardial tissue was optoacoustically monitored by means of pulsed-laser illumination in the near-infrared spectrum. Lesion formation during ablation was captured at a rate of 10 Hz with a 256-detector optoacoustic imaging probe. Post-ablated samples were imaged using multispectral excitation in the wavelength range 740 nm to 860 nm to determine the lesion contrast spectrum. Tomographic reconstruction was performed to generate three-dimensional images of the lesions, which were compared to photographs depicting the final ablated tissue samples. Video-rate three-dimensional tomographic reconstructions depict formation of the lesion with high contrast and spatial resolution. The size and geometry of the lesion was shown to be in excellent agreement with the histological examinations. The wavelength dependence of the lesion contrast shows a contrast peak near 780 nm. CONCLUSION: Deep-tissue three-dimensional monitoring of RFA lesion generation in real time was demonstrated for the first time in this work. The results suggest the potential of optoacoustic monitoring for providing critical feedback on lesion position and size during radiofrequency catheter ablation, improving safety and efficacy of these treatments

Optoacoustic monitoring of real-time lesion formation during radiofrequency catheter ablation.

Current radiofrequency cardiac ablation procedures lack real-time lesion monitoring guidance, limiting the reliability and efficacy of the treatment. The objective of this work is to demonstrate that optoacoustic imaging can be applied to develop a diagnostic technique applicable to radiofrequency ablation for cardiac arrhythmia treatment with the capabilities of real-time monitoring of ablated lesion size and geometry. We demonstrate an optoacoustic imaging method using a 256-detector optoacoustic imaging probe and pulsed-laser illumination in the infrared wavelength range that is applied during radiofrequency ablation in excised porcine myocardial tissue samples. This technique results in images with high contrast between the lesion volume and unablated tissue, and is also capable of capturing time-resolved image sequences that provide information on the lesion development process. The size and geometry of the imaged lesion were shown to be in excellent agreement with the histological examinations. This study demonstrates the first deep-lesion real-time monitoring for radiofrequency ablation generated lesions, and the technique presented here has the potential for providing critical feedback that can significantly impact the outcome of clinical radiofrequency ablation procedures. © (2015) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE). Downloading of the abstract is permitted for personal use only

Non-contact optoacoustic imaging with focused air-coupled transducers.

Non-contact optoacoustic imaging employing raster-scanning of a spherically focused air-coupled ultrasound transducer is showcased herein. Optoacoustic excitation with laser fluence within the maximal permissible human exposure limits in the visible and near-infrared spectra is applied to objects with characteristic dimensions smaller than 1 mm and absorption properties representative of the whole blood at near-infrared wavelengths, and these signals are shown to be detectable without contact to the sample using an air-coupled transducer with reasonable signal averaging. Optoacoustic images of vessel-mimicking tubes embedded in an agar phantom captured with this non-contact sensing technique are also showcased. These initial results indicate that an air-coupled ultrasound detection approach can be suitable for non-contact biomedical imaging with optoacoustics

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response

Non-contact optoacoustic imaging by raster scanning a piezoelectric air-coupled transducer.

Optoacoustic techniques rely on ultrasound transmission between optical absorbers within tissues and the measurement location. Much like in echography, commonly used piezoelectric transducers require either direct contact with the tissue or through a liquid coupling medium. The contact nature of this detection approach then represents a disadvantage of standard optoacoustic systems with respect to other imaging modalities (including optical techniques) in applications where non-contact imaging is needed, e.g. in open surgeries or when burns or other lesions are present in the skin. Herein, non-contact optoacoustic imaging using raster-scanning of a spherically-focused piezoelectric air-coupled ultrasound transducer is demonstrated. When employing laser fluence levels not exceeding the maximal permissible human exposure, it is shown possible to attain detectable signals from objects as small as 1 mm having absorption properties representative of blood at near-infrared wavelengths with a relatively low number of averages. Optoacoustic images from vessel-mimicking tubes embedded in an agar phantom are further showcased. The initial results indicate that the air-coupled ultrasound detection approach can be potentially made suitable for non-contact biomedical imaging with optoacoustics