12 research outputs found
Highly multiplexed single-cell quantitative PCR
<div><p>We present a microfluidic device for rapid gene expression profiling in single cells using multiplexed quantitative polymerase chain reaction (qPCR). This device integrates all processing steps, including cell isolation and lysis, complementary DNA synthesis, pre-amplification, sample splitting, and measurement in twenty separate qPCR reactions. Each of these steps is performed in parallel on up to 200 single cells per run. Experiments performed on dilutions of purified RNA establish assay linearity over a dynamic range of at least 10<sup>4</sup>, a qPCR precision of 15%, and detection sensitivity down to a single cDNA molecule. We demonstrate the application of our device for rapid profiling of microRNA expression in single cells. Measurements performed on a panel of twenty miRNAs in two types of cells revealed clear cell-to-cell heterogeneity, with evidence of spontaneous differentiation manifested as distinct expression signatures. Highly multiplexed microfluidic RT-qPCR fills a gap in current capabilities for single-cell analysis, providing a rapid and cost-effective approach for profiling panels of marker genes, thereby complementing single-cell genomics methods that are best suited for global analysis and discovery. We expect this approach to enable new studies requiring fast, cost-effective, and precise measurements across hundreds of single cells.</p></div
Methods for Multiplex Template Sampling in Digital PCR Assays
<div><p>The efficient use of digital PCR (dPCR) for precision copy number analysis requires high concentrations of target molecules that may be difficult or impossible to obtain from clinical samples. To solve this problem we present a strategy, called Multiplex Template Sampling (MTS), that effectively increases template concentrations by detecting multiple regions of fragmented target molecules. Three alternative assay approaches are presented for implementing MTS analysis of chromosome 21, providing a 10-fold concentration enhancement while preserving assay precision.</p></div
Multiplex Template Sampling (MTS) strategies.
<p>In the first, “short multiplex”, the sampling rate is raised by ten primer pairs in a multiplexed PCR with a common fluorescent probe for detection. The second method, “long multiplex”, is similar, but loci-specific primers are longer and we append a universal sequence to them. A third method, “repetitive simplex”, uses a single PCR assay designed to target chromosome-specific repetitive sequences.</p
Assessment of chromosome ratio using “short” and “long” multiplexing strategies.
<p>(<b>A</b>) Mean ratio (n = 5) between chromosomes 21 and 6 in normal human adult male DNA as measured by dPCR using ten different primer pairs each specific to one locus on chromosome 21. (<b>B</b>) Mean ratio (n = 5) between chromosome 21 and chromosome 6 as measured by dPCR using multiplexed reactions with one to ten primer pairs in the PCR mix. Reaction volumes are 2 nL, multiplexing level (horizontal axis) increases from 1× to 10×. Two approaches compared: with short primers and long primers plus a pair of universal primers. Upper and lower boundaries of 95% confidence intervals <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0098341#pone.0098341-Dube1" target="_blank">[22]</a> are shown with dashed lines.</p
Multiplex RT-qPCR device schematic and operation.
<p>(A) Two cell-processing units. Components include (i) a reagent injection bus, (ii) a 0.3-nL cell capture chamber, (iii) a 10-nL reverse transcription (RT) chamber, (iv) a 50-nL pre-amplification chamber, (v) twenty 0.15-nL sample-splitting chambers, (vi) twenty shared assay-delivery chambers, and (vii) twenty 6.4-nL detection chambers. The “flow” layer is made up of features of six different heights. Control valves and assay-delivery channels are on the same 25 μm high SU8 “control” layer. Assay delivery from the control layer to the flow layer occurs through laser-ablated interlayer connections. Scale bar 0.5 mm. (B) Optical micrograph of a single K562 cell (indicated by a black arrow) caught in a cell trap. Scale bar 50 μm. (C) Optical micrograph of a subsection of the detection array. Control valves are coloured red. Scale bar 0.5 mm. (D-G) Schematic illustration of device operation. (D) Single cells are first loaded into the device, then washed, isolated, and lysed <i>in situ</i>. (E) Reverse transcription brew is then injected into the RT chamber, mixed with the lysate, and then the device is thermocycled. (F) Similarly, multiplexed pre-amplification mix is injected into the device, mixed with cDNA, and then the device is again thermocycled. (G) Finally, the pre-amplification product is split between detection chambers for qPCR.</p
Effect of volume on dPCR reactions.
<p>Performance of same PCR mixes as in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0098341#pone-0098341-g001" target="_blank">Figure 1B</a> in 100 pL volumes. Two multiplexing approaches are compared: short primers and long primers plus a pair of universal primers. Multiplexing level in PCR reactions (horizontal axis) increases from 1× to 10×. Asterisks denote data points where difference between the two approaches was not significant (p = 0.05).</p
Single cell mRNA expression.
<p>(A) Heatmap of expression values of six mRNA on 175 single K562 cells and 4 no cell controls (NCC). Each column represents a cell, and each row represents an assay. Replicate measurements are grouped according to assay. As expected, murine <i>Gapdh</i> is not detected, only spuriously generating signal in 4/525 detection chambers. No-cell controls are clearly distinguishable from those from single cells, with an average difference in magnitude greater than 100×. The variability between replicate measurements for each gene is much smaller than the variance in expression seen between different cells. (B) Distribution of the copy number of each gene measured in each single cell, along with the mean expression values obtained from previously published single-cell qPCR measurements [<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0191601#pone.0191601.ref010" target="_blank">10</a>, <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0191601#pone.0191601.ref012" target="_blank">12</a>, <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0191601#pone.0191601.ref014" target="_blank">14</a>, <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0191601#pone.0191601.ref030" target="_blank">30</a>]. Error bars represent the mean ± standard deviation.</p
dPCR quality comparison between “short” and “long” multiplexing strategies.
<p>(<b>A</b>) Boxplots for comparison of Ct values (vertical axis) distribution in 2 nL PCR compartments filled with variable multiplexing level (horizontal axis) primer mixes. Upper panel – PCR mixes supplemented with short primers. Lower panel – PCR mixes supplemented with combination of long and plus a pair of universal primers. Red crosses denote outliers that are larger than the 75<sup>th</sup> percentile plus 1.5× the interquartile range or smaller than the 25<sup>th</sup> percentile minus 1.5× the interquartile range. This corresponds to approximately ±2.7σ and 99.3% coverage assuming that the data are normally distributed. (<b>B</b>) The ratio between mean fluorescence in positive chambers in dPCR arrays and background fluorescence in negative chambers.</p
Pairs of long and short oligonucleotides used in multiplexed PCR reactions.
<p>Short primers are shown in bold. The first ten pairs target different loci on chromosome 21. The last pair targets RNAse P on chromosome 6. The oligonucleotides used for long multiplex experiments are full sequences listed in the table, with the addition of the universal sequence GACTGACTGCGTAGGTATTATCG (designated as U1 in the table) for forward primers and CACAGGAAACAGCTATGACC (designated as U2 in the table) for the reverse at 5′ end of the primers. The primers used for the repetitive simplex experiments target ten loci on chromosome 21 and were CCTGGTCTGCACCCCAGTG and GTGCAGGAGCTGGTGCAG, and were used with probe #74 (Cat. #04688970001) from the Roche Universal Probe Library which anneals to the CTGCTGCCC motif.</p>*<p>Universal sequences on 5′ ends of long pairs are not shown.</p