Uridine Composition of the Poly-U/UC Tract of HCV RNA Defines Non-Self Recognition by RIG-I

<div><p>Viral infection of mammalian cells triggers the innate immune response through non-self recognition of pathogen associated molecular patterns (PAMPs) in viral nucleic acid. Accurate PAMP discrimination is essential to avoid self recognition that can generate autoimmunity, and therefore should be facilitated by the presence of multiple motifs in a PAMP that mark it as non-self. Hepatitis C virus (HCV) RNA is recognized as non-self by RIG-I through the presence of a 5′-triphosphate (5′-ppp) on the viral RNA in association with a 3′ poly-U/UC tract. Here we define the HCV PAMP and the criteria for RIG-I non-self discrimination of HCV by examining the RNA structure-function attributes that impart PAMP function to the poly-U/UC tract. We found that the 34 nucleotide poly-uridine “core” of this sequence tract was essential for RIG-I activation, and that interspersed ribocytosine nucleotides between poly-U sequences in the RNA were required to achieve optimal RIG-I signal induction. 5′-ppp poly-U/UC RNA variants that stimulated strong RIG-I activation efficiently bound purified RIG-I protein <em>in vitro</em>, and RNA interaction with both the repressor domain and helicase domain of RIG-I was required to activate signaling. When appended to 5′-ppp RNA that lacks PAMP activity, the poly-U/UC U-core sequence conferred non-self recognition of the RNA and innate immune signaling by RIG-I. Importantly, HCV poly-U/UC RNA variants that strongly activated RIG-I signaling triggered potent anti-HCV responses <em>in vitro</em> and hepatic innate immune responses <em>in vivo</em> using a mouse model of PAMP signaling. These studies define a multi-motif PAMP signature of non-self recognition by RIG-I that incorporates a 5′-ppp with poly-uridine sequence composition and length. This HCV PAMP motif drives potent RIG-I signaling to induce the innate immune response to infection. Our studies define a basis of non-self discrimination by RIG-I and offer insights into the antiviral therapeutic potential of targeted RIG-I signaling activation.</p> </div

HCV poly-U/UC RNA variants trigger differential anti-HCV and hepatic innate immune responses.

<p>A) Huh7 cells were transfected with the indicated poly-U/UC RNA constructs 12 hours prior to HCV infection (MOI = 0.1), and virus production was assessed 48 hours post-infection. Data shown are means ± s.d. for three replicates. Asterisks indicate a significant difference compared to No RNA control as determined by a one-way ANOVA adjusted with Bonferroni's multiple comparison test (*P<0.001, **P≤0.0001). B) Wild-type mice (n = 2) received 200 µg of X-region RNA, X-region-U34 RNA, Con1 pU/UC RNA, or Δcore RNA. Mock-transfected wild-type mice (n = 1) received PBS. Comparative measurements of hepatic mRNA and protein expression were measured 8 hours post-transfection. Real-time quantitative PCR was performed to examine expression of <i>IFN-β</i>, <i>CCL5</i>, <i>Ifit2</i>, <i>ISG15</i>, and <i>GAPDH</i>. Results were normalized to the expression of mouse <i>GAPDH</i> mRNA, and mRNA fold index was normalized to Mock controls. Data shown are means ± s.d. for two replicates, and gene expression data was confirmed by two independent real-time PCR analyses. Asterisks indicate a significant difference as determined by a one-way ANOVA adjusted with Bonferroni's multiple comparison test (*P<0.05, **P<0.01, ***P<0.001). C) Following RNA transfection, mouse livers were recovered and immunohistochemistry staining was conducted for mouse ISG54. The black scale bar indicates a distance of 500 µm.</p

HCV poly-U/UC RNA constructs interact with the RIG-I RD and helicase domain.

<p>A) Limited-trypsin proteolysis of 30 pmol purified RIG-I with increasing amounts of RNA. Repressor domain, RD; helicase domain and CARDs, Helic. +CARDs. B) Limited trypsin proteolysis of 30 pmol purified RIG-I protein with 1.0 pmol of each indicated RNA construct. RIG-I digestion products were separated on the same gel and relative band intensities (listed as % of total) were measured using ImageJ gel imaging software (NIH). C) ATPase activity of purified RIG-I protein incubated with increasing amounts of RNA. Data shown are means ± s.d. for two replicates.</p

HCV poly-U/UC RNA constructs developed for RIG-I binding and activation studies.

a<p>The X-region RNA construct has the sequence 5′-GGUGGCUCCAUCUUAGCCCUAGUCACGGCUAGCUGUGAAAGGUCCGUGAGCCGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCUCUGCAGAUCAAGU-3′. The X-region-U34 RNA construct has the sequence 5′-GGGUGGCUCCAUCUUAGCCCUAGUCACGGCUAGCUGUGAAAGGUCCGUGAGC(U34)CGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCUCUGCAGAUCAAGU-3′.</p>b<p>All RNAs include a 5′-ppp and three guanine nucleotides at the 5′ end of the RNA. Dashes indicate nucleotide deletions, and underlined nucleotides show changes from the HCV Con1 poly-U/UC sequence. Long homo-polymeric nucleotide sequences are indicated in parentheses with the nucleotide designation followed by the number of nucleotides in the sequence.</p

HCV poly-U/UC RNA constructs activate RIG-I signaling.

<p>A) Induction of the IFN-β-promoter in Huh7 cells transfected with equal moles of tRNA, full-length JFH1, JFH1 pU/UC, or Con1 pU/UC RNA. IFN-β-promoter luciferase activity is shown as mean IFN-β fold index (compared to cells with No RNA, ± s.d. for three replicates). Huh7 cells were transfected with the various RNA constructs and 16 hours later cells were harvested for dual luciferase activity. Asterisks indicate a significant difference compared to No RNA control as determined by a one-way ANOVA adjusted with Bonferroni's multiple comparison test (*P<0.05, **P<0.01, ***P<0.001). B) Induction of the IFN-β-promoter in Huh7 or Huh7.5 cells transfected with 350 ng of the indicated RNA constructs. IFN-β-promoter luciferase activity is shown as the mean IFN-β fold index ± s.d. for three replicates, and data was normalized to the No RNA control. Cells were harvested for dual luciferase activity 16 hours post-RNA transfection. Asterisks indicate a significant difference compared to No RNA control as determined by a one-way ANOVA adjusted with Bonferroni's multiple comparison test (*P<0.05, **P<0.001). C) The abundance of phospho-IRF-3 (Ser396), total IRF-3, RIG-I, ISG56, and tubulin were measured by immunoblot. Huh7 cells were transfected with the indicated RNA constructs and cells were harvested for protein analysis 16 hours later. RIG-I and ISG56 are IFN-β-stimulated genes. The ratio of phospho-IRF-3/total IRF-3 was calculated by measuring the relative immunoblot band intensities using ImageJ software (NIH). Data shown in all panels are representative of three independent experiments.</p

HCV poly-U/UC sequence variability.

a<p>DNA sequences were obtained from GenBank, converted to RNA sequences, and aligned to examine sequence variability. Duplicate sequences were removed from the alignment, and sequences are listed as [GenBank Accession #.Genotype].</p>b<p>Within the 5′arm of the pU/UC tract, genotype 1 nucleotide composition ranged from 12.1–44.4% purine nucleotides; genotype 2 nucleotide composition ranged from 16.7–50% purine nucleotides.</p>c<p>Within the 3′arm of the pU/UC tract, genotype 1 nucleotide composition ranged from 0 (16 sequences)–11.6% purine nucleotides; genotype 2 nucleotide composition ranged from 5.0–11.4% purine nucleotides.</p

Survival and Virologic Analysis for Wild-Type and IRF-3^−/− C57BL/6 Mice

<div><p>(A) Eight- to twelve-week-old mice were inoculated with 10² PFU of WNV by footpad injection and followed for mortality for 21 d. Survival differences were statistically significant (<i>n</i> = 20, IRF-3^−/−; and <i>n</i> = 20, wild-type mice; <i>p</i> < 0.0001).</p><p>(B–G) Viral burden in peripheral and CNS tissues after WNV infection. WNV RNA in (B) serum and (C) draining lymph node, and infectious virus in the (D) spleen, (E) kidney, (F) brain, and (G) spinal cord were determined from samples harvested on days 1, 2, 4, 6, 8, and 10 using qRT-PCR (B, C) or viral plaque assay (D–G). Data is shown as viral RNA equivalents or PFU per gram of tissue for ten to 12 mice per time point. For all viral load data, the solid line represents the median PFU per gram at the indicated time point, and the dotted line represents the limit of sensitivity of the assay. Error bars indicate the standard deviations (SD). Asterisks indicate values that are statistically significant (*, <i>p</i> < 0.05; **, <i>p</i> < 0.005; ***, <i>p</i> < 0.0001) compared to wild-type mice.</p></div

Proteomic Analysis of Mitochondrial-Associated ER Membranes (MAM) during RNA Virus Infection Reveals Dynamic Changes in Protein and Organelle Trafficking

<div><p>RIG-I pathway signaling of innate immunity against RNA virus infection is organized between the ER and mitochondria on a subdomain of the ER called the mitochondrial-associated ER membrane (MAM). The RIG-I adaptor protein MAVS transmits downstream signaling of antiviral immunity, with signaling complexes assembling on the MAM in association with mitochondria and peroxisomes. To identify components that regulate MAVS signalosome assembly on the MAM, we characterized the proteome of MAM, ER, and cytosol from cells infected with either chronic (hepatitis C) or acute (Sendai) RNA virus infections, as well as mock-infected cells. Comparative analysis of protein trafficking dynamics during both chronic and acute viral infection reveals differential protein profiles in the MAM during RIG-I pathway activation. We identified proteins and biochemical pathways recruited into and out of the MAM in both chronic and acute RNA viral infections, representing proteins that drive immunity and/or regulate viral replication. In addition, by using this comparative proteomics approach, we identified 3 new MAVS-interacting proteins, RAB1B, VTN, and LONP1, and defined LONP1 as a positive regulator of the RIG-I pathway. Our proteomic analysis also reveals a dynamic cross-talk between subcellular compartments during both acute and chronic RNA virus infection, and demonstrates the importance of the MAM as a central platform that coordinates innate immune signaling to initiate immunity against RNA virus infection.</p></div

Levels of type I IFN levels in serum of wild type and DKO mice infected with WNV.

<p>Mice were inoculated with 10² PFU of WNV by footpad injection and sacrificed at the indicated times. Type I IFN levels were determined from serum collected on days 1 to 4 after WNV infection by an EMCV bioassay in L929 cells. Data reflect averages of serum samples from 5 to 10 mice per time point and the data are expressed as international units (IU) of IFN-α per ml. The specificity of the assay was confirmed with an anti-IFN-αβR neutralizing antibody (data not shown). Asterisks indicate values that are statistically significant (**, P<0.005, *, P<0.05).</p

IRF-3 Modulates WNV Infection in Primary Macrophages

<div><p>(A) Macrophages generated from wild-type or IRF-3^−/− mice were infected at an MOI of 0.01, and virus production was evaluated at the indicated times post infection by plaque assay. Values are an average of quadruplicate samples generated from at least three independent experiments. Error bars represent the SD, and asterisks indicate differences that are statistically significant relative to wild-type mice (*, <i>p</i> < 0.05; **, <i>p</i> < 0.005; ***, <i>p</i> < 0.0001).</p><p>(B) The induction of IFN-α and IFN-β mRNA in WNV-infected macrophages was analyzed by qRT-PCR as described in <a href="http://www.plospathogens.org/article/info:doi/10.1371/journal.ppat.0030106#ppat-0030106-g002" target="_blank">Figure 2</a>.</p><p>(C, D) Accumulation of IFN-α (C) and IFN-β (D) protein in supernatants of WNV-infected macrophages was determined by ELISA. The data is the average of at least five independent experiments performed in triplicate. *, <i>p</i> < 0.05.</p><p>(E) The induction of IRF-7 mRNA in WNV-infected macrophages was analyzed by qRT-PCR as described in <a href="http://www.plospathogens.org/article/info:doi/10.1371/journal.ppat.0030106#ppat-0030106-g002" target="_blank">Figure 2</a>. *, <i>p</i> < 0.05.</p></div