Prevalence of Giardia Assemblages Among Equines in Jordan

A cross-sectional study was carried out on 400 equine holding (326 horses and 74 donkeys) samples to determine the prevalence of Giardia assemblages A, B, and E in Jordan. Identifying the Giardia assemblages was carried out using enzyme-linked immunosorbent assay (ELISA) as a screening test and PCR-RFLP targeting β-giardin loci. In addition, polymerase chain reaction targeting triose phosphate isomerase gene specific for assemblages A and B were used as confirmatory. Thirty-four samples tested positive by ELISA for Giardia with an apparent prevalence of 8.5%. The PCR-RFLP test confirmed Giardia assemblages in 30 of the 34 ELISA-positive samples giving a true prevalence of 7.7% (95% confidence interval: 4.8–10.1). Of the 30 positive animals/holdings, 18, 4, and 8 had assemblages A, B, and E. Assemblage A was significantly (P < .05) more prevalent when compared to assemblages B and E. The total infection rates of Giardia, assemblages B and E were significantly (P < .05, chi-square) higher in donkeys 14.8%, 2.7%, and 5.5% compared to horses 5.8%, 0.6%, and 1.2%, respectively. Analysis of risk factors revealed that only season was significantly associated with the different Giardia assemblages. Autumn (odds ratio [OR] = 0.09) was associated with Giardia infection regardless of the assemblage type as reducing factor. The odds of infection of assemblages A and E increased in winter (OR = 6.8) and spring (OR = 4.5), respectively. Giardia assemblages A, B, and E infect both horses and donkeys in Jordan with potential impact on human and animal health, and the odds of infections is significantly associated with season

Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR

A two-tube real-time assay, developed in a LightCyclerTM, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5′-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3′) and a universal downstream probe Cy5 (5′-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO4-3′), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024–1048 and 1050–1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 °C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of and 56 °C determined from temperature-dependent dye–DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli–C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples