The effect of exogenous dihydroxyacetone and methylglyoxal on growth, anthocyanin accumulation, and the glyoxalase system in Arabidopsis

Dihydroxyacetone (DHA) occurs in wide-ranging organisms, including plants, and can undergo spontaneous conversion to methylglyoxal (MG). While the toxicity of MG to plants is well-known, the toxicity of DHA to plants remains to be elucidated. We investigated the effects of DHA and MG on Arabidopsis. Exogenous DHA at up to 10 mM did not affect the radicle emergence, the expansion of green cotyledons, the seedling growth, or the activity of glyoxalase II, while DHA at 10 mM inhibited the root elongation and increased the activity of glyoxalase I. Exogenous MG at 1.0 mM inhibited these physiological responses and increased both activities. Dihydroxyacetone at 10 mM increased the MG content in the roots. These results indicate that DHA is not so toxic as MG in Arabidopsis seeds and seedlings and suggest that the toxic effect of DHA at high concentrations is attributed to MG accumulation by the conversion to MG

Circadian clock control of Nox4 and reactive oxygen species in the vasculature.

Recent studies have shown that circadian clock disruption is associated with pathological remodeling in the arterial structure and vascular stiffness. Moreover, chronic circadian disruption is associated with dysfunction in endothelial responses and signaling. Reactive oxygen species have emerged as key regulators in vascular pathology. Previously, we have demonstrated that circadian clock dysfunction exacerbates superoxide production through eNOS uncoupling. To date, the impact of circadian clock mutation on vascular NADPH oxidase expression and function is not known. The goal in the current study was to determine if the circadian clock controls vascular Nox4 expression and hydrogen peroxide formation in arteries, particularly in endothelial and vascular smooth muscle cells. In aorta, there was an increase in hydrogen peroxide and Nox4 expression in mice with a dysfunctional circadian rhythm (Bmal1-KO mice). In addition, the Nox4 gene promoter is activated by the core circadian transcription factors. Lastly, in synchronized cultured human endothelial cells, Nox4 gene expression exhibited rhythmic oscillations. These data reveal that the circadian clock plays an important role in the control of Nox4 and disruption of the clock leads to subsequent production of reaction oxygen species

Increased Nox4 protein expression in cultured aortic endothelial and smooth muscle cells of Bmal1-KO mice.

<p>Vascular smooth muscle and endothelial cells were isolated and cultured from aortae of WT and Bmal1-KO mice (passage 2-3). Nox4 expression levels were determined by immunoblotting and revealed a significant increase in Nox4 in vascular endothelial cells (<b>A</b>) and smooth muscle cells (<b>B</b>) from Bmal1-KO animals relative to wild-type mice. Changes were quantified by densitometry (^*p<0.05 versus WT, n=3).</p

Increased Nox4 gene expression in aorta of Bmal1-KO mice.

<p>Aortae from WT and Bmal1-KO mice were isolated between ZT2 and ZT4, cryopreserved and total RNA isolated. Relative gene expression was assessed by qRT-PCR for Nox4 (forward primer, TGTTGCATGTTTCAGGTGGT; reverse, AAAACCCTCGAGGCAAAGAT) and Nox1(forward primer, CATGGCCTGGGTGGGATTGT; reverse, TGGGAGCGATAAAAGCGAAGGA) in mouse aorta and normalized to 18S. Bmal1-KO mice exhibited a significant increase in Nox4 gene expression (*P<0.05, n=6).</p

Bmal1 knockdown increases hydrogen peroxide in human aortic smooth muscle cells.

<p>(<b>A</b>) Western blot showing reduction in Bmal1 expression in human aortic smooth muscle cells incubated with antisense-Bmal1 adenovirus for 24 hours. (<b>B</b>) Knockdown of Bmal1 triggered an increase in H₂O₂ but (<b>C</b>) no detectable change in O₂^{. -} levels in human aortic smooth muscle cells (HASMC). (n=8, *p<0.05) (<b>D</b>) Relative expression of Bmal1 and Nox4 versus B-actin and GAPDH in human aortic smooth muscle cells transfected with siRNA-Bmal1or control siRNA (30nM, n=3-5).</p

Nox4 promoter is regulated by the circadian clock.

<p>Human Nox4 promoter transactivation was assessed by a dual luciferase assay in transfected COS cells expressing the Nox4 promoter Gaussian luciferase in the presence and absence CLOCK, Bmal1, NPAS2, Bmal1+NPAS2 andBmal1+Clock. Cotransfection with Bmal1 and NPAS2 or Bmal1 and Clock significantly induced Nox4 promoter activity (*p<0.05 versus control, n=5). </p

Bmal1 knockdown increases hydrogen peroxide and superoxide in human aortic endothelial cells.

<p>(<b>A</b>) Western blot showing reduction in Bmal1 expression in human aortic endothelial cells incubated with antisense-Bmal1 adenovirus. (<b>B</b>) Knockdown of Bmal1 resulted in increased H2O2 and superoxide (<b>C</b>) Relative expression of Bmal1 and Nox4 versus B-actin and GAPDH in human aortic endothelial cells transfected with siRNA-Bmal1or control siRNA (30nM, n=3-5). (<b>D</b>) Relative expression of Bmal1 and Nox4 versus β-actin and GAPDH in human aortic endothelial cells transfected with siRNA-Bmal1or control siRNA. Knockdown of Bmal1 increased Nox4 protein (n=8, *p<0.05 by one way ANOVA).</p