Genetic and Cytological Analysis of a Novel Type of Low Temperature-Dependent Intrasubspecific Hybrid Weakness in Rice

<div><p>Hybrid weakness (HW) is an important postzygotic isolation which occurs in both intra- and inter-specific crosses. In this study, we described a novel low temperature-dependent intrasubspecific hybrid weakness in the F₁ plants derived from the cross between two <i>indica</i> rice varieties Taifeng A and V1134. HW plants showed growth retardation, reduced panicle number and pale green leaves with chlorotic spots. Cytological assay showed that there were reduced cell numbers, larger intercellular spaces, thicker cell walls, and abnormal development of chloroplast and mitochondria in the mature leaves from HW F₁ plants in comparison with that from both of the parental lines. Genetic analysis revealed that HW was controlled by two complementary dominant genes <i>Hw3</i> from V1134 and <i>Hw4</i> from Taifeng A. <i>Hw3</i> was mapped in a 136 kb interval between the markers Indel1118 and Indel1117 on chromosome 11, and <i>Hw4</i> was mapped in the region of about 15 cM between RM182 and RM505 on chromosome 7, respectively. RT-PCR analysis revealed that only <i>LOC_Os11g44310</i>, encoding a putative calmodulin-binding protein (<i>OsCaMBP</i>), differentially expressed among Taifeng A, V1134 and their HW F₁. No recombinant was detected using the markers designed based on the sequence of <i>LOC_Os11g44310</i> in the BC₁F₂ (Taifeng A//Taifeng A/V1134) population. Hence, <i>LOC_Os11g44310</i> was probably the candidate gene of <i>Hw3</i>. Gene amplification suggested that <i>LOC_Os11g44310</i> was present in V1134 and absent in Taifeng A. BLAST search revealed that <i>LOC_Os11g44310</i> had one copy in the <i>japonica</i> genomic sequence of Nipponbare, and no homologous sequence in the <i>indica</i> reference sequence of 9311. Our results indicate that <i>Hw3</i> is a novel gene for inducing hybrid weakness in rice.</p></div

Phenotypic characterizations of the seedlings of Taifeng A, V1134 and their F₁ grown under 21°C and 32°C.

<p>These 3-week-old seedlings grown in August, 2011 were treated under the conditions of 21°C and 32°C for ten days, respectively. (a) under 21°C. (b) under 32°C.</p

Phenotypic characterization of hybrid weakness in rice plants.

<p>(<b>a</b>) The morphology of the 40-day seedlings of Taifeng A, V1134 and their F₁. (b) The leaf phenotypes of HW F₁ and both parents’ 40-day seedlings. (c) The morphology of the HW F₁ and their parents at mature stage.</p

Transmission electron microscopic (TEM) observations of organelle structure of leaves and root tips in Taifeng A, V1134 and their F₁ plants.

<p>The F₁ and its parents were planted in the early-growing season with relative low temperatures for 5 weeks. (a and b) Chloroplast structures of the parents. (c) Chloroplast structure of the HW F₁ plants. (d and e) Mitochondria structure of the leaves from the parent plants. (f) Mitochondria structure of leaves in the HW F₁ plants. (g) and (h) Mitochondria structure of root tips from the parents. (i) Mitochondria structure of root tips from the HW F₁ plants. Bars indicate 100 nm (a–f), 50 nm (g–i).</p

Amplification of the candidate gene between Taifeng A and V1134.

<p>(a) With the seven markers (CBP1-CBP7) specific to the seven divided segments of the candidate gene. I–VII: The markers of CBP1, CBP2……CBP7, respectively.</p

Cellular responses of the leaves from Taifeng A, V1134 and their HW F₁ stained with trypan blue.

<p>Cellular responses of the leaves from Taifeng A, V1134 and their HW F₁ stained with trypan blue.</p

Linkage map of the <i>Hw3</i> gene and cosegregation analysis.

<p>(a) Linkage map of the <i>Hw3</i> gene. (b) Cosegregation analysis in the BC₁F₂ population of Taifeng A//Taifeng A/V1134 using the specific marker CBP2 (F: 5′ AGCATCTGGAAGCGGTTTTG 3′, R: 5′ CCATCTGCCTGTCACTATCATT 3′, the predicted size: 948 bp). P1: V1134. P2: Taifeng A. NR: the number of recombinants.</p

DNA sequence alignment between the amplified sequence in Taifeng A using the primers CBP3 and CBP4 and the reference sequence of Nipponbare.

<p>(A) Using the primer CBP3. (B) Using the primer CBP4. <b>Bold:</b> Location of selected alignment. <b>Highlighted Gray:</b> Location of the Exons.</p

The SPAD values and the photosynthetic rates for Taifeng A, V1134 and the HW F_1.

<p>The SPAD values and the photosynthetic rates for Taifeng A, V1134 and the HW F_1.</p

Agronomic traits for Taifeng A, V1134 and their HW F₁ plants.

<p>CL culm length, PL panicle length, PN panicle number, SN spikelet number.</p