The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

A wide variety of Clostridium perfringens type A food-borne isolates that carry a chromosomal cpe gene belong to one multilocus sequence typing cluster

Of 98 suspected food-borne Clostridium perfringens isolates obtained from a nationwide survey by the Food and Consumer Product Safety Authority in The Netherlands, 59 strains were identified as C. perfringens type A. Using PCR-based techniques, the cpe gene encoding enterotoxin was detected in eight isolates, showing a chromosomal location for seven isolates and a plasmid location for one isolate. Further characterization of these strains by using (GTG)5 fingerprint repetitive sequence-based PCR analysis distinguished C. perfringens from other sulfite-reducing clostridia but did not allow for differentiation between various types of C. perfringens strains. To characterize the C. perfringens strains further, multilocus sequence typing (MLST) analysis was performed on eight housekeeping genes of both enterotoxic and non-cpe isolates, and the data were combined with a previous global survey covering strains associated with food poisoning, gas gangrene, and isolates from food or healthy individuals. This revealed that the chromosomal cpe strains (food strains and isolates from food poisoning cases) belong to a distinct cluster that is significantly distant from all the other cpe plasmid-carrying and cpe-negative strains. These results suggest that different groups of C. perfringens have undergone niche specialization and that a distinct group of food isolates has specific core genome sequences. Such findings have epidemiological and evolutionary significance. Better understanding of the origin and reservoir of enterotoxic C. perfringens may allow for improved control of this organism in foods

Differential outgrowth potential of Clostridium perfringens food-borne isolates with various cpe-genotypes in vacuum-packed ground beef during storage at 12°C

In the current study, the outgrowth of spores of 15 different food isolates of Clostridium perfringens was evaluated in vacuum-packed ground beef during storage at 12 °C and 25 °C. This included enterotoxic strains carrying the gene encoding the CPE enterotoxin on the chromosome (C-cpe), on a plasmid (P-cpe) and cpe-negative strains. The 15 strains were selected from a larger group of strains that were first evaluated for their ability to sporulate in modified Duncan–Strong sporulating medium. Sporulation ability varied greatly between strains but was not associated with a particular cpe genotype. In line with previous studies, the tested C-cpe strains produced spores with significantly higher heat resistance than the cpe-negative and P-cpe strains (both IS1151 and IS1470-like) with the exception of strain VWA009. Following inoculation of vacuum-packed cooked ground beef with spores, the heat-resistant C-cpe strains showed lower outgrowth potential in this model food stored at 12 °C than the P-cpe and cpe-negative strains, while no significant differences were observed at 25 °C. These results suggest that the latter strains may have a competitive advantage over C-cpe strains at reduced temperatures during storage of foods that support the growth of C. perfringens. While spores of P-cpe strains are readily inactivated by heat processing, post-processing contamination by food handlers who may carry P-cpe strains that have a better growth potential at lower temperatures must be avoided. The varying responses of C. perfringens spores to heat and the differences in outgrowth capacity at different temperatures are factors to be considered in strain selection for challenge tests, and for predictive modelling of C. perfringens

Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated in a high-temperature, short-time pasteurization process (72°C for 15 s). To obtain heat-resistant strains, 48 strains were exposed to 55°C for up to 3 h. The energy of activation constant and inactivation constant of strains that survived best (strains 1E and NV8) were subsequently determined in a continuous-flow-through system. Strain Scott A was taken along as a reference. The 3 strains were cultured in whole milk and in brain heart infusion broth at 30 and 7°C. Strains 1E and NV8 were significantly more heat resistant than was strain Scott A after growth in brain heart infusion broth at 30°C and after growth in milk at 7°C. From the inactivation parameters, it was calculated that exposure to high-temperature, short-time pasteurization (72°C for 15 s) will result in 12.1-, 14.2-, and 87.5-log reductions for the strains 1E, NV8, and Scott A, respectively. These results demonstrate that industrial pasteurization conditions suffice to inactivate the most heat-resistant L. monocytogenes strains tested in this stud

The growth limits of a large number of Listeria monocytogenes strains at combinations of stresses show serotype- and niche-specific traits

Aims: The aim of this study was to associate the growth limits of Listeria monocytogenes during exposure to combined stresses with specific serotypes or origins of isolation, and identify potential genetic markers. Methods and Results: The growth of 138 strains was assessed at different temperatures using combinations of low pH, sodium lactate, and high salt concentrations in brain heart infusion broth. None of the strains was able to grow at pH ¿ 4·4, aw ¿ 0·92, or pH ¿ 5·0 combined with aw ¿ 0·94. In addition, none of the strains grew at pH ¿ 5·2 and NaLac ¿ 2%. At 30°C, the serotype 4b strains showed the highest tolerance to low pH and high NaCl concentrations at both pH neutral (pH 7·4) and mild acidic conditions (pH 5·5). At 7°C, the serotype 1/2b strains showed the highest tolerance to high NaCl concentrations at both pH 7·4 and 5·5. Serotype 1/2b meat isolates showed the highest tolerance to low pH in the presence of 2% sodium lactate at 7°C. ORF2110 and gadD1T1 were identified as potential biomarkers for phenotypic differences. Conclusions: Differences in growth limits were identified between specific L. monocytogenes strains and serotypes, which could in some cases be associated with specific genetic markers. Significance and Impact of the Study: Our data confirm the growth limits of L. monocytogenes as set out by the European Union for ready-to-eat foods and provides an additional criterion. The association of L. monocytogenes serotypes with certain stress responses might explain the abundance of certain serotypes in retail foods while others are common in clinical cases