The impact of human capital outsourcing on human capital management practices in Karachi pharmaceutical industry

Purpose: The aim of this research is to examine relationship between Human Capital Management (HRM) and Human Resource (HR) Outsourcing in the Pharmaceutical sector. The specific objective is to find out that how important is HRM for an Organization to perform its operations more efficiently, and at what level Human Resource Outsourcing is affecting it. Literature review: Literature review shows that HR outsourcing has positive impact on HRM for an Organization to perform its operations more efficiently. Methods: In order to conduct this research the methodology that has been used is quantitative in nature and closed ended Questionnaire was used to collect data. The universe of study was the employees of Pharmaceutical industry in Karachi Pakistan. The responses of each respondent were thoroughly analyzed by using SPSS software, and the results show that there is a negative relationship between the Human Capital Management (Gaining Knowledge, Current Trend of Business Environment, Organization Managing Their Human Asset and Practices and Policies Regarding Human Resource) and HR Outsourcing. Conclusions: It is concluded that all Independent Variables have the strongest Positive correlation with each other. There are lots of constraints, which any organization faces in terms of time, finance and, in some cases factors like strategic focus.Human Capital Management, Karachi, Pharmaceutical, Outsourcing

Applying a mixed-method approach to improve on-the-job learning and job satisfaction in a cohort of interns at a university hospital

Introduction: Job satisfaction is vital for the optimal functioning of medical practitioners. Herein, we report our experience of restructuring the internship program by identifying the gaps, developing, implementing strategies to overcome gaps and sharing the results of the pre-implementation and post-implementation audit, as an example for establishing a system for improving intern\u27s work-based learning and satisfaction in a university hospital setting.Methods: Using Kern\u27s six-step instructional model, a prospective mixed-method study was conducted at Aga Khan University Hospital. In phase 1 (2013) gaps were identified by evaluating various aspects of the internship program. Strategies were developed and implemented to overcome the identified gaps. In phase 2 (2014-2016) the impact of these developmental strategies was assessed.Results: A total of 65 interns, 30 residents, and 22 faculty members participated in phase I, while 71 interns participated in phase II. The reformation of orientation sessions, including practical exposure and content of sessions, opportunities to enhance hands-on experience and supervision in inpatient areas, operating rooms, supervision by fellows, supervision for hands-on procedures, career counseling, and mentorship, led to significant improvement in satisfaction. It was identified that the lack of hands-on opportunities can be overcome by surgical skills-based workshops. These reforms led to an overall rise in intern satisfaction (50% vs 75.4%, p=0.02).Conclusion: Periodic restructuring of an existing program helps to improve the work-based learning experience and overall satisfaction among interns. This not only maximizes learning but also eases interns into their postgraduate life and workload subsequently enabling them to become more competent and well-rounded health practitioners

Re-structuring university hospital’s internship program using kern’s six-step model of Instructional design

Abstract Background: Internship is a phase of training wherein a graduate learns in the context of practice, acquiring skills under supervision so that he/she may become capable of functioning independently. We are reporting the process of curriculum restructuring for strengthening the Internship Program at this university hospital. Methodology: We used Kerns’ six-step model to evaluate and restructure the internship curriculum. Step 01: Problem Identification & General need assessment- Thorough literature review revealed Internship as the crucial year of training that needs to be fashioned around the competencies required to make good doctor

The Chemical Composition and Health-Promoting Effects of the Grewia Species—A Systematic Review and Meta-Analysis

Globally grown and organoleptically appreciated Grewia species are known as sources of bioactive compounds that avert the risk of communicable and non-communicable diseases. Therefore, in recent years, the genus Grewia has attracted increasing scientific attention. This is the first systematic review which focusses primarily on the nutritional composition, phytochemical profile, pharmacological properties, and disease preventative role of Grewia species. The literature published from 1975 to 2021 was searched to retrieve relevant articles from databases such as Google Scholar, Scopus, PubMed, and Web of Science. Two independent reviewers carried out the screening, selection of articles, and data extraction. Of 815 references, 56 met our inclusion criteria. G. asiatica and G. optiva were the most frequently studied species. We found 167 chemical compounds from 12 Grewia species, allocated to 21 categories. Flavonoids represented 41.31% of the reported bioactive compounds, followed by protein and amino acids (10.7%), fats and fatty acids (9.58%), ash and minerals (6.58%), and non-flavonoid polyphenols (5.96%). Crude extracts, enriched with bioactive compounds, and isolated compounds from the Grewia species show antioxidant, anticancer, anti-inflammatory, antidiabetic, hepatoprotective/radioprotective, immunomodulatory, and sedative hypnotic potential. Moreover, antimicrobial properties, improvement in learning and memory deficits, and effectiveness against neurodegenerative ailments are also described within the reviewed article. Nowadays, the side effects of some synthetic drugs and therapies, and bottlenecks in the drug development pathway have directed the attention of researchers and pharmaceutical industries towards the development of new products that are safe, cost-effective, and readily available. However, the application of the Grewia species in pharmaceutical industries is still limited

MoO3 altered ZnO: A suitable choice for the photocatalytic removal of chloro-acetic acids in natural sunlight exposure

The MoO3 coated ZnO photocatalysts were synthesized for the optimum harvesting of the absorbed ultraviolet sunlight photons by initially permeating Mo6+ ions at the surface of pre-synthesized ZnO and finally transformed to MoO3 by thermal treatment in the air. The absorption spectra of the synthesized powders revealed the extension of the absorption edge in the visible region whereas, the photoluminescence spectroscopy established the supporting role of the MoO3 coating in gradually plummeting the excitons recombination. The growth of additional peaks in Raman as well as X-ray photoelectron spectra and the appearance of the corresponding low-intensity reflection substantiated the surface prevalence of MoO3. The absence of the individual particles of MoO3 in FESEM and the verification of coated layer by HRTEM images validated the authenticity of the adopted synthetic route. The electrochemical evaluation of the synthesized powders under illumination revealed the complete elimination of photocorrosion and the synergic role of the MoO3 layer for improved trap and transfer of charge carriers. The evaluation of the flat-band potentials of the coated powders by Mott-Schottky analysis revealed the suitability of the conduction band edges for the generation of superoxide anion radicals. The photocatalytic activity of the synthesized powders was assessed for the removal of chloro derivatives (mono-, di-, trichloroacetic acids) in comparison to pure acetic acid. A significant effect of the stability, polarity and stereochemical structure of the substrate on the photocatalytic removal process was observed and discussed. The experimental evidences from the time-scale chemical analysis were interpreted for the identification of the reactive oxygen species (ROS) involved in the degradation/mineralization process. The validation of the Langmuir-Hinshelwood kinetic model was also examined. Efforts were made to estimate the plausible route of the degradation/mineralization process

The impact of human capital outsourcing on human capital management practices in Karachi pharmaceutical industry

Purpose: The aim of this research is to examine relationship between Human Capital Management (HRM) and Human Resource (HR) Outsourcing in the Pharmaceutical sector. The specific objective is to find out that how important is HRM for an Organization to perform its operations more efficiently, and at what level Human Resource Outsourcing is affecting it. Literature review: Literature review shows that HR outsourcing has positive impact on HRM for an Organization to perform its operations more efficiently. Methods: In order to conduct this research the methodology that has been used is quantitative in nature and closed ended Questionnaire was used to collect data. The universe of study was the employees of Pharmaceutical industry in Karachi Pakistan. The responses of each respondent were thoroughly analyzed by using SPSS software, and the results show that there is a negative relationship between the Human Capital Management (Gaining Knowledge, Current Trend of Business Environment, Organization Managing Their Human Asset and Practices and Policies Regarding Human Resource) and HR Outsourcing. Conclusions: It is concluded that all Independent Variables have the strongest Positive correlation with each other. There are lots of constraints, which any organization faces in terms of time, finance and, in some cases factors like strategic focus

Phytochemical Profile, Biological Properties, and Food Applications of the Medicinal Plant Syzygium cumini

Syzygium cumini, locally known as Jamun in Asia, is a fruit-bearing crop belonging to the Myrtaceae family. This study aims to summarize the most recent literature related to botany, traditional applications, phytochemical ingredients, pharmacological activities, nutrition, and potential food applications of S. cumini. Traditionally, S. cumini has been utilized to combat diabetes and dysentery, and it is given to females with a history of abortions. Anatomical parts of S. cumini exhibit therapeutic potentials including antioxidant, anti-inflammatory, analgesic, antipyretic, antimalarial, anticancer, and antidiabetic activities attributed to the presence of various primary and secondary metabolites such as carbohydrates, proteins, amino acids, alkaloids, flavonoids (i.e., quercetin, myricetin, kaempferol), phenolic acids (gallic acid, caffeic acid, ellagic acid) and anthocyanins (delphinidin-3,5-O-diglucoside, petunidin-3,5-O-diglucoside, malvidin-3,5-O-diglucoside). Different fruit parts of S. cumini have been employed to enhance the nutritional and overall quality of jams, jellies, wines, and fermented products. Today, S. cumini is also used in edible films. So, we believe that S. cumini’s anatomical parts, extracts, and isolated compounds can be used in the food industry with applications in food packaging and as food additives. Future research should focus on the isolation and purification of compounds from S. cumini to treat various disorders. More importantly, clinical trials are required to develop low-cost medications with a low therapeutic inde

The evaluation of the photocatalytic activity of magnetic and non-magnetic polymorphs of Fe2O3 in natural sunlight exposure: a comparison of photocatalytic activity

The non-magnetic and magnetic polymorphs of iron oxide (Fe2O3) namely: alpha-Fe2O3 (hematite) and gamma-Fe2O3 (maghemite) respectively, were synthesized by a facile surfactant aided hydrogel route. The synthesized polymorphs were characterized by diffuse reflectance, photoluminescence and raman spectroscopy for optical properties whereas the morphological, structural, chemical and electronic state evaluation were performed by FESEM, HRTEM, XRD, and XPS. The charge transport and the stability of the materials were examined electrochemically. The photocatalytic activity of the synthesized polymorphs was evaluated for the degradation of 2-chlorophenol and 2-nitrophenol in the exposure of the visible region and complete spectrum natural sunlight. Both the polymorphs exhibited a significantly high activity for the degradation of the phenolic substrate in the exposure of the complete spectrum of sunlight, however, the activity in the visible region of the sunlight was relatively lower. A substantial increase in the activity in the visible region was noticed when the polymorphs were exposed to complete spectrum sunlight prior to the photocatalytic experiments. The comparison of the exposed and unexposed samples revealed the induction of defects that served as traps for the excited electrons and increased activity of the polymorphs. (C) 2018 Elsevier B.V. All rights reserved

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei

Sawdust amendment in agricultural and pasture soils can reduce iodine losses

Iodine loss is common in the soil of hilly regions due to higher precipitation rates and steeper slopes. Iodine deficiency in soil reduces iodine’s bioavailability to fruits and vegetables and consequently may contribute to health complications. However, the iodine retention of soils after the addition of selected organic and inorganic amendments has not been studied. Therefore, a study was carried out to investigate iodine loss during surface runoff. For this purpose, a soil amendment (namely, sawdust, charcoal, wood ash, lime or gypsum) was applied separately to pasture and agricultural soils under natural rainfall conditions. The soil was fertigated with iodine in the form of potassium iodide (KI) at the rate of 200 ppm. Surface runoff was related to soil properties. Results showed that iodine content in surface runoff was linearly related with soil pH (R2 = 0.89, p charcoal > wood ash > lime > gypsum. The study results indicated that organic amendments, especially sawdust, improved soil properties and increased the iodine retention capacity of soils