Direct transcriptional repression of the genes encoding the zinc-finger proteins Gfi1b and Gfi1 by Gfi1b

Gfi1b is a 37 kDa transcriptional repressor with six zinc-finger domains that is differentially expressed during hemato- and lymphopoiesis. We show here that transcription from the Gfi1b gene locus is silenced in the spleen but not in the bone marrow of transgenic mice that constitutively express Gfi1b under the control of the pan-hematopoietic vav promoter. Sequence analysis of the Gfi1b promoter showed the presence of potential Gfi1/Gfi1b-binding sites close to the mRNA start site. The expression of reporter gene constructs containing the Gfi1b core promoter appended to the luciferase gene were strongly repressed in the presence of exogenous Gfi1b. Moreover, analysis of combinatorial mutant mice that carry the vav-Gfi1b transgene and a green fluorescent protein-tagged Gfi1 gene locus demonstrated that the Gfi1 gene can be repressed by Gfi1b. Direct binding of Gfi1b and Gfi1 to the potential binding sites in the Gfi1b promoter could be demonstrated by gel-shift analyses in vitro. Chromatin-immunoprecipitation experiments showed that both the Gfi1b and the Gfi1 promoter are indeed occupied by Gfi1b in vivo. Hence, we conclude from our data that Gfi1b can auto-repress its own expression, but, in addition, is also able to cross-repress expression of the Gfi1 gene most likely in a cell type specific manner

Human–mouse sequence homology, DNase I hypersensitive sites and Gfi1/Gfi1b binding sites overlap around exon 1 of Gfi1b () Mapping of DNase I hypersensitive sites

<p><b>Copyright information:</b></p><p>Taken from "Direct transcriptional repression of the genes encoding the zinc-finger proteins Gfi1b and Gfi1 by Gfi1b"</p><p>Nucleic Acids Research 2005;33(3):987-998.</p><p>Published online 17 Feb 2005</p><p>PMCID:PMC549408.</p><p>© The Author 2005. Published by Oxford University Press. All rights reserved</p> Nuclei of splenocytes from a wild-type mouse (C57Bl/6) were isolated and digested with the indicated amount of DNase I for 15 min on ice. After SmaI digestion, the DNA was separated by 0.8% agarose gel electrophoresis, transferred to a nylon membrane and hybridized with a PCR generated P-labeled 285 bp probe covering the most 5′ end directly downstream of the SmaI site. The result was visualized by autoradiography. The sequences for the primers to generate the probe were SmaUS1, cctgggatccttcagtggcagag; and SmaLS1, gtcctggaactccctctatagaac. The positions of the core promoter, exon 1 and exon 2 relative to the 5′-SmaI site were indicated. The detected hypersensitive sites were marked H1–H4. () High similarities (S1–S5) between mouse and human sequences overlap with the mapped hypersensitive sites (H1–H4), exon 2, the core promoter sequence (prom) and the regions where putative Gfi1/Gfi1b binding sites (diamonds) reside. These similarities are even higher as within the non-coding exon 1

Gfi1 and Gfi1b act equivalently in haematopoiesis, but have distinct, non-overlapping functions in inner ear development

Gfi1 is a transcriptional repressor essential for haematopoiesis and inner ear development. It shares with its paralogue Gfi1b an amino-terminal SNAG repressor domain and six carboxy-terminal zinc-finger motifs, but differs from Gfi1b in sequences separating these domains. Here, we describe two knock-in mouse models, in which the N-terminal SNAG repressor domain was mutated or in which the Gfi1 coding region was replaced by Gfi1b. Mouse mutants without an intact SNAG domain show the full phenotype of Gfi1 null mice. However, Gfi1:Gfi1b knock-in mice show almost normal pre-T-cell and neutrophil development, but lack properly formed inner ear hair cells. Hence, our findings show that an intact SNAG domain is essential for all functions of Gfi1 and that Gfi1b can replace Gfi1 functionally in haematopoiesis but, surprisingly, not in inner ear hair cell development, demonstrating that Gfi1 and Gfi1b have equivalent and domain-dependent, cell type-specific functions

<i>Growth Factor Independence 1b</i> (<i>Gfi1b</i>) Is Important for the Maturation of Erythroid Cells and the Regulation of Embryonic Globin Expression

<div><p>Growth factor independence 1b (GFI1B) is a DNA binding repressor of transcription with vital functions in hematopoiesis. <i>Gfi1b</i>-null embryos die at midgestation very likely due to defects in erythro- and megakaryopoiesis. To analyze the full functionality of <i>Gfi1b</i>, we used conditionally deficient mice that harbor floxed <i>Gfi1b</i> alleles and inducible (<i>Mx</i>-Cre, Cre-ERT) or erythroid specific (<i>EpoR</i>-Cre) Cre expressing transgenes. In contrast to the germline knockout, <i>EpoR</i>-Cre mediated erythroid specific ablation of <i>Gfi1b</i> allows full gestation, but causes perinatal lethality with very few mice surviving to adulthood. Both the embryonic deletion of <i>Gfi1b</i> by <i>EpoR</i>-Cre and the deletion in adult mice by <i>Mx</i>-Cre or Cre-ERT leads to reduced numbers of erythroid precursors, perturbed and delayed erythroid maturation, anemia and extramedullary erythropoiesis. Global expression analyses showed that the <i>Hba-x</i>, <i>Hbb-bh1</i> and <i>Hbb-y</i> embryonic globin genes were upregulated in <i>Gfi1b</i> deficient TER119⁺ fetal liver cells over the gestation period from day 12.5–17.5 p.c. and an increased level of <i>Hbb-bh1</i> and <i>Hbb-y</i> embryonic globin gene expression was even maintained in adult <i>Gfi1b</i> deficient mice. While the expression of <i>Bcl11a</i>, a regulator of embryonic globin expression was not affected by <i>Gfi1b</i> deficiency, the expression of <i>Gata1</i> was reduced and the expression of <i>Sox6</i>, also involved in globin switch, was almost entirely lost when <i>Gfi1b</i> was absent. These findings establish <i>Gfi1b</i> as a regulator of embryonic globin expression and embryonic and adult erythroid maturation.</p></div

<i>Gfi1b</i> regulates maturation of erythroid cells in adult mice.

<p>A: <i>Gfi1b</i>^fl/fl mice either carrying (<i>Gfi1b</i>-KO) the <i>Mx</i>-Cre transgene or not (wild type) were treated five times with pIpC (500 µg each) every other day and sacrificed for analysis 42 days after the first injection. B: Flow cytometric analysis of progenitors (middle panel) and maturing erythrocytes from the bone marrow (upper and lower panel) and spleen (lower panel) of wild type and <i>Gfi1b</i>-KO mice. TER119⁺ bone marrow cells from pIpC induced wild type and <i>Gfi1b</i> knockout animals were isolated by flow cytometry and RNA was prepared for microarray analysis of gene expression as indicated (lower left panel). FACS plots are representative for at least four individual samples from each genotype. C: Peripheral blood of wild type and conditional <i>Gfi1b</i>-KO mice was analyzed using an ADVIA hematology system and the comparison results are presented as box-whisker plots showing the central location and distribution of the indicated measures. Red blood cell count (RBC), hematocrit (HCT), hemoglobin (HGB), macrocytic RBCs (Macro), mean corpuscular volume (MCV), reticulocytes (Retic), red cell size and shape (RDW), immature reticulocytes fraction high (IRF-H) and white blood cell count (WBC).</p

<i>Gfi1b</i> deficiency causes delayed and incomplete silencing of embryonic globin genes.

<p>A: Q-PCR analysis of embryonic globin gene and <i>Gata1</i> expression in CD71⁺, TER119⁻ and CD71⁺, TER119⁺ fetal liver cells from wild type and <i>EpoR</i>-Cre induced <i>Gfi1b</i> knockout embryos at 15.5 dpc. Bar graphs show the fold change of expression of the indicated genes in <i>Gfi1b</i> knockout cells over the wild type expression. Error bars indicate the standard deviation of at least three replicates. B: Line graphs represent the results of the Q-PCR analysis of globin gene expression in fetal liver cells of <i>EpoR</i>-Cre, <i>Gfi1b</i>^fl/fl (<i>Gfi1b</i> KO) or wild type (WT) mice during developmental stages from 10.5 dpc to 16.5 dpc depicted as percent of total globin (logarithmic scale). Error bars represent the standard deviation from triplicate measurements from two (10.5 and 13.5 dpc) to four (12.5, 14.5, 15.5, 16.5 dpc) individuals of each genotype. C: Bar graph representing the results of triplicate Q-PCR analysis of the expression of globin genes, Gata-1 and -2 in <i>Gfi1b</i>^GFP/GFP homozygous <i>Gfi1b</i> deficient mice compared to heterozygous and wild type littermates at 13.5 dpc. Numbers above bars are fold changes calculated as 2^{(Δct KO – Δct WT)}.</p

Ablation of <i>Gfi1b</i> in adult <i>Rosa</i>-Cre-ERT, <i>Gfi1b</i>^GFP/fl mice by tamoxifen confirms defects in erythroid cell fate decision and maturation causing compensated anemia.

<p>A: Protocol used to efficiently generate adult <i>Gfi1b</i>-KO mice using tamoxifen. Eight week old <i>Gfi1b</i>^fl/GFP mice either carrying a Cre-ERT knock-in into the <i>Rosa</i>26 locus (inducible <i>Gfi1b</i>-KO) or not (wt control) were treated by gavage with tamoxifen (100 mg/kg body weight) freshly dissolved in corn-oil at day 0, 1, 2 and 5 and sacrificed for analysis at day 14 of the experiment. B: Flow cytometric analysis of total bone marrow cells or FACS sorted Lin⁻, cKit⁺ cells from wild type and <i>Gfi1b</i>-KO mice for the presence of the indicated markers (TER119, CD71, CD34 and CD16/32. C: Flow cytometric analysis of stress erythropoiesis in the spleen using cells from wild type (left panel) or <i>Gfi1b</i>-KO (right panel) mice. FACS plots from (B) and (C) are representative for three or more individual samples from each genotype.</p

Deregulation of embryonic globin genes in <i>Gfi1b</i> deficient TER119⁺ cells.

<p>A: Scatter plot comparison of gene expression levels (log2 of normalized signal intensities) in TER119⁺ pIpC induced <i>Mx</i>-Cre, <i>Gfi1b</i>^fl/fl bone marrow cells compared to pIpC induced cells from control mice. Dots represent probesets and are jittered for better visualization. Probesets were classified as indicated and probesets for hemoglobin genes and important regulators of hemoglobin gene expression and globin switch were labeled (red dots). Two RNA samples for each genotype were pooled and analyzed on single arrays. B: Scatter plot comparing the changes in gene expression induced by inactivation of <i>Gfi1b</i> in erythroid cells of adult mice (y-axis) as in (A) with genes regulated in fetal liver cells during development of the mouse embryo from 11 dpc (E11) compared to 16 dpc (E16). Raw data for fetal liver development was taken from GEO data series GSE13149 and reanalyzed. Embryonic globin genes (red), megakaryocyte/platelet specific genes (blue) and integrins known to be targets of <i>Gfi1b</i> in hematopoietic stem cells (yellow) are indicated. Genes that are downregulated in fetal liver cells during mouse development but upregulated in <i>Gfi1b</i>-KO cells are likely to be direct targets of the transcriptional repressor <i>Gfi1b</i> and were subjected to GSEA analysis (green frame and table to the right) and show a high enrichment in megakaryocytic/coagulation related genes and globin genes.</p

Insufficient activation of <i>Sox6</i>, <i>Gata1</i> and <i>Gpa</i> in <i>Gfi1b</i> deficient cells.

<p>A: Q-PCR analysis of the relative expression levels of regulators of globin gene expression (<i>Gata1</i>), globin gene switch (<i>Blc11a, Sox6</i>) and glycophorin A (<i>Gypa</i>) normalized to <i>Gapdh</i>. Sample sizes were as described in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0096636#pone-0096636-g007" target="_blank">Figure 7B</a>. B: Q-PCR analysis on RNA from CD71⁺, TER119⁻ (pro-erythroblasts) and TER119⁺ (late erythroblasts) live bone marrow cells from a surviving <i>EpoR</i>-Cre induced <i>Gfi1b</i>-KO mouse compared to a wild type littermate. All measurements were done in triplicates. C: RT-PCR detection of <i>EpoR</i>-Cre and <i>Gfi1b</i> wt, flox and KO (excised) alleles on total RNA from bone marrow of a surviving mouse with erythroid specific inactivation of <i>Gfi1b</i> by <i>EpoR</i>-Cre.</p