Evaluation of Intra-Host Variants of the Entire Hepatitis B Virus Genome

Genetic analysis of hepatitis B virus (HBV) frequently involves study of intra-host variants, identification of which is commonly achieved using short regions of the HBV genome. However, the use of short sequences significantly limits evaluation of genetic relatedness among HBV strains. Although analysis of HBV complete genomes using genetic cloning has been developed, its application is highly labor intensive and practiced only infrequently. We describe here a novel approach to whole genome (WG) HBV quasispecies analysis based on end-point, limiting-dilution real-time PCR (EPLD-PCR) for amplification of single HBV genome variants, and their subsequent sequencing. EPLD-PCR was used to analyze WG quasispecies from serum samples of patients (n = 38) infected with HBV genotypes A, B, C, D, E and G. Phylogenetic analysis of the EPLD-isolated HBV-WG quasispecies showed the presence of mixed genotypes, recombinant variants and sub-populations of the virus. A critical observation was that HBV-WG consensus sequences obtained by direct sequencing of PCR fragments without EPLD are genetically close, but not always identical to the major HBV variants in the intra-host population, thus indicating that consensus sequences should be judiciously used in genetic analysis. Sequence-based studies of HBV WG quasispecies should afford a more accurate assessment of HBV evolution in various clinical and epidemiological settings

Epidemic History and Evolutionary Dynamics of Hepatitis B Virus Infection in Two Remote Communities in Rural Nigeria

BACKGROUND: In Nigeria, hepatitis B virus (HBV) infection has reached hyperendemic levels and its nature and origin have been described as a puzzle. In this study, we investigated the molecular epidemiology and epidemic history of HBV infection in two semi-isolated rural communities in North/Central Nigeria. It was expected that only a few, if any, HBV strains could have been introduced and effectively transmitted among these residents, reflecting limited contacts of these communities with the general population in the country. METHODS AND FINDINGS: Despite remoteness and isolation, approximately 11% of the entire population in these communities was HBV-DNA seropositive. Analyses of the S-gene sequences obtained from 55 HBV-seropositive individuals showed the circulation of 37 distinct HBV variants. These HBV isolates belong predominantly to genotype E (HBV/E) (n=53, 96.4%), with only 2 classified as sub-genotype A3 (HBV/A3). Phylogenetic analysis showed extensive intermixing between HBV/E variants identified in these communities and different countries in Africa. Quasispecies analysis of 22 HBV/E strains using end-point limiting-dilution real-time PCR, sequencing and median joining networks showed extensive intra-host heterogeneity and inter-host variant sharing. To investigate events that resulted in such remarkable HBV/E diversity, HBV full-size genome sequences were obtained from 47 HBV/E infected persons and P gene was subjected to Bayesian coalescent analysis. The time to the most recent common ancestor (tMRCA) for these HBV/E variants was estimated to be year 1952 (95% highest posterior density (95% HPD): 1927-1970). Using additional HBV/E sequences from other African countries, the tMRCA was estimated to be year 1948 (95% HPD: 1924-1966), indicating that HBV/E in these remote communities has a similar time of origin with multiple HBV/E variants broadly circulating in West/Central Africa. Phylogenetic analysis and statistical neutrality tests suggested rapid HBV/E population expansion. Additionally, skyline plot analysis showed an increase in the size of the HBV/E-infected population over the last approximately 30-40 years. CONCLUSIONS: Our data suggest a massive introduction and relatively recent HBV/E expansion in the human population in Africa. Collectively, these data show a significant shift in the HBV/E epidemic dynamics in Africa over the last century

Characteristics of Adults in the Hepatitis B Research Network in North America Reflect Their Country of Origin and Hepatitis B Virus Genotype

Chronic hepatitis B virus (HBV) infection is an important cause of cirrhosis and hepatocellular carcinoma worldwide; populations that migrate to the US and Canada might be disproportionately affected. The Hepatitis B Research Network (HBRN) is a cooperative network of investigators from the United States and Canada, created to facilitate clinical, therapeutic, and translational research in adults and children with hepatitis B. We describe the structure of the network and baseline characteristics of adults with hepatitis B enrolled in the network

Hepatitis B Virus and Hepatitis C Virus Infections in United States-Bound Refugees from Asia and Africa

Photograph of a scene with Great Plains Chautauqua reenactors

Detection of co-infections, subpopulations and recombination.

<p>(<b>a</b>) Maximum likelihood trees of HBV-WG quasispecies (blue) and consensus WG sequences from a single patient (viral titer of 10⁶ IU/ml). HBV quasispecies belong to genotypes A and G, while consensus WG sequences (red) obtained at two time-points belong to genotype A. (<b>b</b>) Maximum likelihood tree of HBV-WG quasispecies from a genotype B infected patient (viral titer of 10⁵ IU/ml). Consensus sequence shown in red belongs to a single HBV subpopulation, while the WG quasispecies shown in blue segregate into 2 subpopulations. (<b>c</b>) Maximum likelihood tree of WG quasispecies (blue) sampled from a patient (viral titer of >10⁶ IU/ml) infected with genotype G and recombinant genotype G/A variants. Consensus sequence (red node) belongs to genotype G. Two HBV WG clones, that are genetically distant from the main cluster of genotype G variants, contain genomic regions belonging to genotype A.</p

Diversity in naive and treated individuals.

<p>Phylogenetic trees of HBV-WG quasispecies (blue) and consensus sequences (red) from: (<b>a</b>) a treatment-naïve patient (viral titer −10³ IU/ml) and (<b>b</b>) a lamivudine-treated patient (viral titer −10⁶ IU/ml).</p

Flowchart of the HBV WG amplification process.

<p>Flowchart of the HBV WG amplification process.</p

Primers used for HBV whole genome quasispecies amplification.

<p><b>Note</b>: Each nested primer also contained adaptor sequence tags for sequencing purpose. The forward primers were tagged with SP6 sequence (5′CGATTTAGGTGACACTATAGAAGAGAGGCT3′), and reverse primers with T7 sequence (5′CAGTAATACGACTCACTATAGGGAGAAGGC3′).</p><p>*Overlapping WG primers (WG-F2 to F4) when used in the first round PCR, additional two nested primers - F7 and F8 are to be added.</p

Integrated HIV surveillance finds recent adult hepatitis B virus (HBV) transmission and intermediate HBV prevalence among military in uncharacterized Caribbean country.

BACKGROUND:Guyana expanded its HIV response in 2005 but the epidemiology of hepatitis B virus (HBV) and hepatitis C virus (HCV) infections has not been characterized. METHODS:The 2011 Seroprevalence and Behavioral Epidemiology Risk Survey for HIV and STIs collected biologic specimens with demographic and behavioral data from a representative sample of Guyana military personnel. Diagnostics included commercial serum: HIV antibody; total antibody to hepatitis B core (anti-HBc); IgM anti-HBc; hepatitis B surface antigen (HBsAg); anti-HBs; antibody to HCV with confirmatory testing; and HBV DNA sequencing with S gene fragment phylogenetic analysis. Chi-square, p-values and prevalence ratios determined statistical significance. RESULTS:Among 480 participants providing serologic specimens, 176 (36.7%) tested anti-HBc-positive. Overall, 19 (4.0%) participants tested HBsAg-positive; 17 (89.5%) of the HBsAg-positive participants also had detectable anti-HBc, including 1 (5.3%) IgM anti-HBc-positive male. Four (6.8%) females with available HBV testing were HBsAg-positive, all aged 23-29 years. Sixteen (16, 84.2%) HBsAg-positive participants had sufficient specimen for DNA testing. All 16 had detectable HBV DNA, 4 with viral load >2x104IU/ml. Sequencing found: 12 genotype (gt) A1 with 99.9% genetic identity between 1 IgM anti-HBc-positive and 1 anti-HBc-negative; 2 gtD1; and 2 with insufficient specimen. No statistically significant associations between risk factors and HBV infection were identified. CONCLUSIONS:Integrated HIV surveillance identified likely recent adult HBV transmission, current HBV infection among females of reproductive age, moderate HBV infection prevalence (all gtA1 and D1), no HCV infections and low HIV frequency among Guyana military personnel. Integrated HIV surveillance helped characterize HBV and HCV epidemiology, including probable recent transmission, prompting targeted responses to control ongoing HBV transmission and examination of hepatitis B vaccine policies