232 research outputs found
Dressing the Emperor: The Role of Three-Dimensional Information Visualization Software in the Development of Three-Dimensional Hydrogeologic Models
This poster was presented at the 2006 Annual Meeting of the Geological Society of America, October 22-25, 2006, Philadelphia, Pa.The goal of this research is to develop a model that describes the saturated and unsaturated groundwater flow in Berrien County, Michigan (1,350 km2), an area containing a complex sequence of glacio-lacustrine deposits. Stone and others (2001) mapped the morphosequences in Berrien County at a scale of 1:24,000, which includes georeferenced structure contours for 20 individual units. We have developed a methodology to translate this detailed morphostratigraphy into a solid three-dimensional geologic model, and then into a three-dimensional block of data that can be used as input to a finite-difference groundwater-flow model. Letsinger and others (2006) describe the process of using geographic information system software to convert the structure contours into georeferenced raster layers that describe each unit. At this stage of the reconstruction, only the bounding surfaces between the units are defined. In order to stack the units in vertical space using customized computer code, a “virtual well field” (regularized two-dimensional array of points) samples each x-y location in each of the 20 rasterized data layers. Units that are intersected from the top bounding surface (surface topography) to the bottom bounding surface (bedrock surface) are then identified. The result of this step is a vector (one-dimensional array) at each virtual well location that describes the elevation of each morphostratigraphic unit boundary intersected at that location. However, at this stage, the model is essentially a regularized three-dimensional point cloud, and three-dimensional information visualization software (3DIVS) is then utilized to generate a solid geologic model by interpolating the vertical geologic “samples” throughout the model domain. A finite-difference grid (“brickpile”) at the chosen resolution of the groundwater-flow model is then generated from the solid geologic model using data-processing functions of the 3DIVS
Dressing the Emperor: The Role of Three-Dimensional Information Visualization Software in the Development of Three-Dimensional Hydrogeologic Models
This poster was presented at the 2006 Annual Meeting of the Geological Society of America, October 22-25, 2006, Philadelphia, Pa.The goal of this research is to develop a model that describes the saturated and unsaturated groundwater flow in Berrien County, Michigan (1,350 km2), an area containing a complex sequence of glacio-lacustrine deposits. Stone and others (2001) mapped the morphosequences in Berrien County at a scale of 1:24,000, which includes georeferenced structure contours for 20 individual units. We have developed a methodology to translate this detailed morphostratigraphy into a solid three-dimensional geologic model, and then into a three-dimensional block of data that can be used as input to a finite-difference groundwater-flow model. Letsinger and others (2006) describe the process of using geographic information system software to convert the structure contours into georeferenced raster layers that describe each unit. At this stage of the reconstruction, only the bounding surfaces between the units are defined. In order to stack the units in vertical space using customized computer code, a “virtual well field” (regularized two-dimensional array of points) samples each x-y location in each of the 20 rasterized data layers. Units that are intersected from the top bounding surface (surface topography) to the bottom bounding surface (bedrock surface) are then identified. The result of this step is a vector (one-dimensional array) at each virtual well location that describes the elevation of each morphostratigraphic unit boundary intersected at that location. However, at this stage, the model is essentially a regularized three-dimensional point cloud, and three-dimensional information visualization software (3DIVS) is then utilized to generate a solid geologic model by interpolating the vertical geologic “samples” throughout the model domain. A finite-difference grid (“brickpile”) at the chosen resolution of the groundwater-flow model is then generated from the solid geologic model using data-processing functions of the 3DIVS
Dressing the Emperor: The Role of GIS in the Development of Three-Dimensional Hydrogeologic Models
This poster was presented at the 2006 Annual Meeting of the Geological Society of America, October 22-25, 2006, Philadelphia, Pa.The U.S. Geological Survey (USGS) (2001) mapped structure contours for the tops of each of 20 individual units in intersecting and overlapping glacial morphosequences in Berrien County, Michigan (1,350 km2), as part of the mapping program of the Central Great Lakes Geologic Mapping Coalition (CGLGMC). We have developed a methodology to translate this detailed morphostratigraphy first into a solid three-dimensional geologic model, and then into a three-dimensional block of data that can be used as input to a finite-difference groundwater-flow model. The technique involves a hybrid approach involving geographic information systems (GIS), three-dimensional information visualization software (3DIVS), and customized data-processing code. The methodology begins by converting Stone’s structure contours (they are attributed vector contours) for each individually mapped unit into a raster surface at a defined grid resolution (200 m x 200 m). The top of the geologic model is the surface topography (digital elevation model), which is also used to derive the drainage network that is an important boundary condition in the groundwater-flow model. The bottom of the geologic model is the bedrock topography, which was also mapped and contoured by USGS (2001). Stone constructed his structure contour model such that the bottom of each map unit is described by the surface contours of the unit that lies immediately below it. Complex interrelationships dictate that the tops of a number of individually mapped units are sometimes required to describe the bottom surfaces of laterally more extensive units. Once all of the requisite raster grids have been derived, they can be manipulated to provide input that is necessary for development of a detailed solid geologic model using 3DIVS. GIS software and custom code are also used to assign hydrogeologic attributes to the elements of the final three-dimensional finite-difference geologic model
Dressing the Emperor: The Role of GIS in the Development of Three-Dimensional Hydrogeologic Models
This poster was presented at the 2006 Annual Meeting of the Geological Society of America, October 22-25, 2006, Philadelphia, Pa.The U.S. Geological Survey (USGS) (2001) mapped structure contours for the tops of each of 20 individual units in intersecting and overlapping glacial morphosequences in Berrien County, Michigan (1,350 km2), as part of the mapping program of the Central Great Lakes Geologic Mapping Coalition (CGLGMC). We have developed a methodology to translate this detailed morphostratigraphy first into a solid three-dimensional geologic model, and then into a three-dimensional block of data that can be used as input to a finite-difference groundwater-flow model. The technique involves a hybrid approach involving geographic information systems (GIS), three-dimensional information visualization software (3DIVS), and customized data-processing code. The methodology begins by converting Stone’s structure contours (they are attributed vector contours) for each individually mapped unit into a raster surface at a defined grid resolution (200 m x 200 m). The top of the geologic model is the surface topography (digital elevation model), which is also used to derive the drainage network that is an important boundary condition in the groundwater-flow model. The bottom of the geologic model is the bedrock topography, which was also mapped and contoured by USGS (2001). Stone constructed his structure contour model such that the bottom of each map unit is described by the surface contours of the unit that lies immediately below it. Complex interrelationships dictate that the tops of a number of individually mapped units are sometimes required to describe the bottom surfaces of laterally more extensive units. Once all of the requisite raster grids have been derived, they can be manipulated to provide input that is necessary for development of a detailed solid geologic model using 3DIVS. GIS software and custom code are also used to assign hydrogeologic attributes to the elements of the final three-dimensional finite-difference geologic model
An Alternative Approach to Aldol Reactions: Gold-Catalyzed Formation of Boron Enolates from Alkynes
Formation of internucleotide 3'-5' phosphoramidate links by direct coupling of phosphoryl and amino groups.
The stepwise synthesis of oligomers derived from 5'-amino-5'-deoxythymidine 3'-phosphate and 5'-amino-5'-deoxy-3'-O-mono-p-methoxytrityl-thymidine is described. The internucleotide phosphoramidate links were formed by condensation of nucleoside 3'-phosphates with aminonucleosides by means of triphenylphosphine and dipridyl disulfide
Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups.
Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates
- …