Transgenic fluorescent <i>Eimeria tenella</i> parasites.

<p>Sporozoite (A), early stage (B) and mature (C) first generation schizonts expressed EYFP predominantly in the parasite nuclei following transfection with the helper plasmid pH 4-IFP2-A and the donor plasmid pHEA-Bac. Late generation merozoite (D) and schizont (E), unsporulated (F) and sporulated (G) oocysts also presented fluorescent nuclei following transfection with pH 4-IFP2-A and pHEA-Bac. In the transfection efficient assays (H), fluorescent parasites in each well (3 wells per group) were counted at 36 h post transfection. The mean and standard deviations were analysed by the Student <i>t</i> test using the SPSS 13.0 software. The significance level was set at 0.05.</p

Isolation of fluorescent oocysts by FACS.

<p>(A) The percentage of fluorescent oocysts increased from 0.01% in the first generation to 48.5% in the fourth generation. (B) EYFP-expressing oocysts (48.5%) from the fourth generation.</p

Primers used during the application and confirmation of <i>piggyBac</i> mediated transfection of <i>Eimeria tenella</i>.

<p>Primers used during the application and confirmation of <i>piggyBac</i> mediated transfection of <i>Eimeria tenella</i>.</p

<i>piggyBac</i> transposon plasmids designed for transfection of <i>Eimeria tenella</i>.

<p>(A) The helper plasmid pH 4-IFP2-A. (B) The donor plasmid pHEA-Bac.</p

Confirmation of exogenous gene insertion.

<p>(A) Southern-blot hybridization using the EYFP gene as the probe. Lanes 1 and 2: transgenic and wild type <i>Eimeria tenella</i> genomic DNA, lane 3: donor plasmid pHEA-Bac (presenting EYFP as a positive control). (B) Southern-blot hybridization using the transposase gene as the probe. Lane 1: transgenic <i>E.tenella</i> genomic DNA, lane2: wild type <i>E.tenella</i> genomic DNA, lane 3: helper plasmid pH 4-IFP2-A (presenting transposase gene as a positive control). (C) PCR for confirmation of insertion of part of pHEA-Bac. The expression cassette “HEA” was only amplified from transgenic parasite genomic DNA and the 3′ and 5′ plasmid flanking sequences lying outside of the ITR sequences in pHEA-Bac were not detected. Lanes including “3′P”, “5′P” and “HEAP” represented positive controls (Amplicons from the plasmid pHEA-Bac).</p

Identification of genomic sequences flanking the piggyBac insertion sites in <i>Eimeria tenella</i>.

a<p>Conservative sequence 1 (CS1):</p><p>GTAATACGACTCACTATAGGGCGAATTGAAGCTGCCCTTTGGTGCAGATGAACTTCAGGGT.</p>b<p>Conservative sequence 2 (CS2):</p><p>GAGGCGGAGTGTCCGCTGTTGCTGTGGGCAGAAAGAGGGCGGCGTAGAGAGGCATTTAGTG.</p>c<p>R2 flanking region was revealed as an AT-rich DNA sequence.</p>d<p>R5 flanking region presented in the form of tandem repeat sequences.</p