Effects of RdRP inhibitors.

<p>(A) The blocked (+)-RNA1_1–191 template was reacted with MBP-Pro A under the presence or absence of indicated conditions, such as standard condition (lane 2), heat at 95°C for 2 min (lane 3), 20 mM EDTA (lane 4), or 0.6% SDS (lane 5). Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The blocked (+)-RNA1_1–191 template was reacted with MBP-Pro A in the presence of RdRP inhibitor PAA (lanes 3–5) or gliotoxin (lanes 6–8) at the indicated concentrations. Lane 1, DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase. The reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”.</p

FHV protein A possesses TNTase activity.

<p>(A) The (−)-RNA1_1–201 substrate was reacted with MBP-Pro A with DIG-labeled UTP mix (65% DIG-labeled UTP together with 35% UTP) in the absence (lane 3) or presence of indicated NTPs (lanes 2, 4–9). (B) The (−)-RNA1_1–201 (lanes 1–4) or (+)-RNA1_1–191 (lanes 5–8) substrates as well as DIG-labeled UTP mix were reacted with MBP-Pro A or MBP-Pro A_GAA as indicated, in the absence (lanes 1, 2, 5, and 6) or presence (lanes 3, 4, 7 and 8) of ATP, CTP, and GTP mix. (C) The (−)-RNA1_1–201 (lanes 2–5) or (+)-RNA1_1–191 (lanes 6–9) substrates were intact (lanes 2, 3, 6 and 7) or 3′-end blocked by oxidation (lanes 4, 5, 8 and 9). The indicated substrates were incubated with DIG-labeled UTP mix in the presence or absence of ATP, CTP, and GTP mix. For (A–C), the substrates and TNTase reaction products were analyzed and detected as described in “Materials and Methods”.</p

FHV protein A possesses RdRP activity.

<p>(A) Electrophoresis analysis of purified MBP-Pro A and its mutants. Lane M, molecular weight markers (in kDa); Lane 1, MBP-Pro A; Lane 2, MBP-Pro A_GAA, the MBP fusion GDD-to-GAA mutant protein A. (B) Schematic of the RNA templates used for RdRP assays. (C) The indicated template, intact or with its 3′ end blocked via oxidation, was incubated with the indicated proteins and DIG RNA Labeling mix. The reaction products were by electrophoresis on a denaturing formaldehyde-agarose gel and detected.Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription (D) The blocked template (−)-RNA1_1–201 was incubated with the indicated proteins. Templates and reaction products were analyzed and detected as in (C). (E) The blocked template (+)-RNA1_1–191 was incubated with the indicated proteins. Templates and reaction products were analyzed on denaturing formaldehyde-agarose gel and detected via Northern blot analysis using the DIG-labeled probes 2 and DIG-labeled probes 3 (GUUCUAGCCCGAAAGGGCAGAGGU). (F) The RNA products synthesized in (C) and (D) were subjected to RT-PCR. Reverse transcription was conducted in the presence or absence of specific RT primers, followed by PCR amplification. PCR products were electrophoresed through 1.0% agarose gel and visualized by ethidium bromide staining. Lane 1, DNA ladder.</p

Effects of different reaction conditions on <i>de novo</i> RNA synthesis.

<p>(A) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A at different temperature. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The synthesized RNA products from the experiments in (A) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments. (C) The template (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A at the different pH. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (D) The synthesized RNA products from the experiments in (C) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments. (E) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A and different concentrations of Mn²⁺. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (F) The synthesized RNA products from the experiments in (E) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments.</p

The RdRP activities of protein A depend on the 3′-proximal nucleotides of RNA1.

<p>(A) The (−)RNA and (+)RNA templates/substrates with different 3′-end sequences are shown. (B) The 3′-OH blocked (+)RNA templates with 3′ -proximal deletion of 0 to 49 nucleotides (lanes 2–7) were reacted with MBP-Pro A as indicated. The templates and RdRP reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. (C) The 3′-OH blocked (−)RNA substrates with 3′-proximal deletion of 0 to 7 nucleotides (lanes 2–6) were reacted with MBP-Pro A as indicated. The substrates and reaction products were analyzed and detected as described in “Materials and Methods”. (D) The blocked (−)-RNA1_1–201A3G, (−)-RNA1_1–201A3C and (−)-RNA1_1–201A3U were reacted with MBP-Pro A. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. (E) The blocked (−)-RNA1_3–201A3G, (−)-RNA1_3–201A3C and (−)-RNA1_3–201A3U templates were reacted with MBP-Pro A. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. For (B-E), lane 1 represents synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription.</p

FHV protein A initiates RNA synthesis via a <i>de novo</i> mechanism.

<p>(A) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A and different concentrations specific RNA primer. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The synthesized RNA products from the experiments in (A) were measured via Bio-Rad Quantity One software, and the relative RdRP activities were determined by comparing the RNA product level in the presence of the indicated concentration of primer with the RNA product level without the primer. Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments.</p

The Self-Interaction of a Nodavirus Replicase Is Enhanced by Mitochondrial Membrane Lipids

<div><p>RNA replication of positive-strand (+)RNA viruses requires the protein-protein interactions among viral replicases and the association of viral replicases with intracellular membranes. Protein A from Wuhan nodavirus (WhNV), which closely associate with mitochondrial membranes, is the sole replicase required for viral RNA replication. Here, we studied the direct effects of mitochondrial membrane lipids (MMLs) on WhNV protein A activity <i>in vitro</i>. Our investigations revealed the self-interaction of WhNV protein A is accomplished via two different patterns (i.e., homotypic and heterotypic self-interactions via different interfaces). MMLs stimulated the protein A self-interaction, and this stimulation exhibited selectivity for specific phospholipids. Moreover, we found that specific phospholipids differently favor the two self-interaction patterns. Furthermore, manipulating specific phospholipid metabolism affected protein A self-interaction and the activity of protein A to replicate RNA in cells. Taken together, our findings reveal the direct effects of membrane lipids on a nodaviral RNA replicase.</p></div

Specific anionic phospholipids favor different types of self-interactions of protein A aa 1–254 and aa 255–480.

<p>(A–C) The homotypic interactions of aa 1–254 and the heterotypic interactions of aa 1–254 and aa 255–480 were examined in the presence of the increasing concentrations of liposomes generated from CL, PA, PG, or PS, respectively. The homotypic or heterotypic interactions in the presence of different liposomes at each concentration are graphed as shown in (C). The homotypic (gray bar) and heterotypic (black bar) interactions in the absence of liposomes are used as the control (1-fold). The increase in homotypic or heterotypic interactions in the presence of different liposomes at each concentration is graphed as the fold of control. Error bars represent S.D. values from at least three independent experiments and the represent results were shown in (A–B).</p

Oligonucleotides used in this work.

<p>Sequence specific primers are designed according to Genbank no. AY962576 (WhNV RNA1). Characters in bold indicate restriction endonuclease sites, and the types are shown in brackets.</p

Specific anionic phospholipids stimulate protein A self-interaction.

<p>(A–B) MBP pull-down was performed on the increasing concentrations (wt/vol) of liposomes generated from specific purified phospholipids with MBP-protA-His-protA complex. The concentrations of liposomes are indicated above each lane. The self-interaction of protein A in the absence of liposomes is used as the control (1-fold). The increases in the self-interaction of protein A at each point concentration of liposomes are graphed as the fold of the control as shown in (E). Error bars represent S.D. values from at least three independently repeated experiments.</p