The ratio of <i>P1</i>-initiated and <i>P2</i>-initiated transcripts during different growth phases.

<p>The <i>gal</i> transcripts were analyzed by 5′-RACE and primer extension followed by 8% DNA sequencing gel electrophoresis (A). MG1655 (WT strain) was grown in LB containing 0.5% galactose. Total RNA was isolated from 1×10⁸ cells at different time points, indicated by vertical arrows in the growth curve (B) and analyzed by 5′-RACE. Each lane in (A) corresponds to the time point indicated in (B).</p

Effect of CRP, cAMP, and GalR on <i>gal</i> operon transcription dynamics.

<p>The ratio of <i>P1</i>-initiated and <i>P2</i>-initiated transcripts during different growth phases was evaluated in (A) MG1655 (WT), (B) MG1655<i>crp</i> (CRP-deficient), (C) MG1655<i>cya</i> (cAMP-deficient), and (D) MG1655<i>galR</i> (GalR-deficient) strains. The <i>gal</i> transcripts were analyzed by 5′-RACE and primer extension assay followed by 8% DNA sequencing gel electrophoresis. Amount of the transcripts from <i>P1</i> and <i>P2</i> promoters is shown in percent of the total <i>gal</i> transcripts.</p

Half-life of the <i>gal</i> transcripts during different growth phases.

<p>Half-life of mRNA at each time point was determined by real-time RT-PCR. *decay rate was too low measure. The standard deviation from three independent experiments at time point of 65 min was too small to be represented in the scale of the figure.</p

Models describing RNA polymerase on <i>gal</i> operon DNAs in the cell population.

<p>(A) Single initiation site model: each <i>gal</i> operon in the cell population is transcribed from the <i>P1</i> promoter only or from the <i>P2</i> promoter only. (B) Mixed initiation site model: each <i>gal</i> operon in the population is transcribed from both promoters, but at a different frequency from each promoter.</p

Time required to double or reduce by half the number of <i>gal</i> transcripts during different growth phases.

1<p>Observed rate: rate of mRNA accumulation.</p>2<p>Actural rate: rate of actual transcription.</p>a<p>negative sign (-) represents the time required to reduce the number of <i>gal</i> transcripts by half.</p

Transcription dynamics of <i>P1</i>-initiated and <i>P2</i>-initiated transcription during the DECREASE period.

<p>Relative numbers of <i>P1</i> and <i>P2</i> transcripts were determined at 240, 300, 360, and 420 min. Rate constants were determined from the slope, and fitted curves are presented. The error bars indicate standard deviation from two independent experiments</p

Plasmids used in this study.

<p>Plasmids are schematically presented along with their names, size in base pairs (bp), and purpose. Genes are depicted as arrows pointing in the direction of transcription. The origin of DNA replication (<i>ori</i>) is presented in a box with the conventional name of the plasmid. pOri14, pHL1105, and pHL1105* have the same sequence except the operator. The following sequences are present at the operator; 5′ATGATCGGTGATCCTG for pOri14, 5′TTGTTAGTCATAACTAACAA for pHL1105, and 5′TTGTTAGTCATAACTCACAA for pHL1105*. pOri14 has 7219 bp, and both pHL1105 and pHL1105* have 7216 bp each.</p

Relative concentration of <i>dic</i> transcripts^*.

*<p>These values were measured by three independent experiments. Average values are presented.</p

Amino acid alignments of DicA with functionally and structurally homologous proteins.

<p>The N-terminal part of DicA lines up well with the N-terminus of the C2 (GenBank: NP_059606.1) protein from the <i>Salmonella</i> phage P22. The C-terminal part of DicA shares significant amino acid sequence homology with the N-termini of RovA (GenBank: AAK01704.1) of <i>Yersinia</i> and SlyA (GenBank: AAL55673.1) of <i>Salmonella</i>. Identical amino acids with DicA are marked in black. The winged helix DNA-binding domain is underlined with the secondary structure labeled. The amino acid sequences are taken from the GenBank database, and the sequence comparison algorithm BLAST <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0045236#pone.0045236-Altschul1" target="_blank">[33]</a> was used.</p

Filamentous growth of MG1655/pCnuK9E.

<p>MG1655 harboring pCnuK9E was grown in LB liquid medium at 37°C. Cells were stained with Hoechst 33342 dye. Cells grew normally when CnuK9E was not induced (A). When the same microscopic field was observed under UV light, each cell had one or two discrete nuclei (B). When CnuK9E was induced, however, the cells adopted a filamentous form (C). MG1655 cells harboring pCnu grew normally when Cnu was overexpressed to the same level of CnuK9E (data not shown). The same cells in C had several discrete nuclear regions when observed under UV light (D).</p