Hydrolysis of D- or L-RNA2 at different D- or L- DNAzyme ratios.

<p>Panel (A) D-DNAzyme hydrolysis of D-RNA2 at enzyme to substrate ratios as indicated in the lanes of the figure. Lane C: D-RNA2 incubated only in buffer, lane C’: D-RNA2 incubated in buffer with 10 mM MgCl₂. Panel (B) L-DNAzyme hydrolysis of L-RNA2 at enzyme to substrate ratios as indicated in the lanes of the figure. Lane C: L-RNA2 incubated only in buffer, lane C’: L-RNA2 incubated in buffer with 10 mM MgCl₂. (C) D-DNAzyme hydrolysis of D-RNA2 (black circles) at enzyme to substrate ratios as indicated in the figure and L-DNAzyme hydrolysis of L-RNA2 (gray squares) at ribozyme to substrate ratios shown in the panel. Incubation periods 3 h for all other conditions see Materials and Methods.</p

Hammerhead Spiegelzyme (34-mer) Stability in Human Blood Sera.

<p>(A) Incubation at 37°C for 0.25–120 h (6 days) in a human blood serum purchased from Sigma <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0054741#pone.0054741-Nolte1" target="_blank">[4]</a>. (B) Incubation at 37°C for 0.25–144 h in serum derived from a whole blood of a healthy blood donor. Blood was collected without anticoagulant and clotting was allowed over night at room temperature. Serum was prepared by centrifugation for 30 min at 3000 rpm in a Heraeus Megafuge 3 or at 4°C und stored in aliquots at −25°C. Serum was tested negative for HIV and hepatitis B and C by routine serological tests. (C) Control-Hammerhead ribozyme (same sequence as the Spiegelzyme) was incubated in serum (as in A) at 37°C for 0.25–120 min. All diagrams show fractions of the intact L-RNA, or D-RNA at a given time point. C-control sample was incubated on ice over time period given.</p

Hydrolysis Experiments of L-RNA2 with T1, V1, S1, and T2 Ribonucleases.

<p>Incubation conditions as described under Materials and Methods. L: alkaline L-RNA2 ladder. The nucleotide sequence of L-RNA2 is indicated. All nucleases were active against D-RNA (data not shown).</p

Hydrolysis of L-DNA1 by an L-Hammerhead Ribozyme and D-DNA1 by a D-Hammerhead Ribozyme at various Mg⁺⁺ Concentrations.

<p>Left panel: Target L-DNA1 in buffer without MgCl₂ (C), the same with 25 mM of MgCl₂ (C’), Target L-DNA1 with a hammerhead Spiegelzyme at 1, 5, 10 and 25 mM MgCl₂, LL control: L-RNA1 incubated with L-hammerhead. Right panel: Target D-DNA1 in buffer without (C’’) and with 25 mM MgCl₂ (C’’’). Target D-DNA1 and hammerhead ribozyme at 1, 5, 10 and 25 mM MgCl₂, DD control: D- RNA1 incubated with D-hammerhead ribozyme. Arrow identifies hydrolysis site as in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0054741#pone-0054741-g001" target="_blank">Fig. 1B</a>.</p

Hammerhead Spiegelzyme Activities in COS-7 cells.

<p>(A) Cells were transfected with 5′-fluorescein labeled L-RNA-1 substrates. Prior to the application of the HH Spiegelzyme, the cells were washed to remove the untransfected substrate from the medium. Then the cells were transfected with 300, 500, 1000 and 3000 nM of the Spiegelzyme. The control transfection was done only with the substrate. To check for the ability of the Spiegelzyme to cross the membrane, the cells were transfected with the fluorescein labeled Spiegelzyme (bottom row, right panel). The microscopic images were taken prior to RNA isolation after washing with PBS buffer. (B) The percentage of uncleaved substrate in the L-RNA-1 isolated from cells transfected with the Spiegelzyme. After incubation for 24 hours, L-RNA was isolated from harvested cells using TRIZOL (Ambion) according to the manufacturer’s protocol. L-RNA-1 was separated by 20% PAGE with 8 M urea and the amount of substrate was determined by the fluorescence intensity using Fuji Film FLA 5100 phosphoimager.</p

Atomic Models Proposed for the L-Hammerhead Ribozyme and the L-DNAzyme Interactions with their Target L-RNA2.

<p>(A) L-HHRz, 5′-U₁GGCGCUGAUGAGGCCGAAAGGCCGAAACUUGA₃₃-3' (shown in blue) with L-RNA2 target nucleotide sequence 5′-C₁UUCAAGUCCGCCA₁₄-3′ (shown in red) with the cleavage site at nucleotide C9 (shown in green), (B) L-DNAzyme 5′-G₁GCGGAGGCTAGCTACAACGATTGAAG₂₇-3′ (shown in blue) with L-RNA2 target nucleotide sequence 5′-C₁UUCAAGUCCGCCA₁₄-3′ (shown in red) with the cleavage site at nucleotide G7 (shown in green). See text for detail discussions of the models.</p

Mapping of accessible sites for oligonucleotide hybridization in the 5’UTRcvb3 RNA.

<p>(A) Schematic representation of the two methods applied to map regions which are accessible to oligonucleotide hybridization. Thick grey lines—complementary oligomers hybridized to RNA; star—radioactive label; dashed arrow—a direction of primer extension; triangle—a site of RNase H induced RNA cleavage. Grey or black lines with an arrow at the end—dsDNA or RNA products of the procedures, respectively. (B) Analysis of Reverse Transcription with Random Oligonucleotide Libraries (RT-ROL) products by sequencing gel electrophoresis. The RT-ROL products were generated with 8- and 12-mer libraries followed by PCR amplification with the radiolabeled RNA-specific primers and the tag primer. Lanes: <i>(-)</i>—reaction control without DNA library; A, G, U, C—RNA sequencing lines; <i>8</i>—random 8-mer library; <i>12</i>—random 12-mer library; a—reactions in the presence of the antitag-oligomer. Selected nucleotide residues are labeled on the left. Figure shows a typical autoradiogram. The other autoradiograms are shown in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0136395#pone.0136395.s001" target="_blank">S1 Fig</a>. (C) Cleavage sites induced by RNase H in the presence of semi-random libraries of deoxynucleotide 6-mers: <i>a</i>, <i>c</i>, <i>t</i>, or <i>g</i>. The reactions were carried out at 37°C for 10 and 30 min with the 5'-end-³²P-labeled 5’UTRcvb3 RNA: Lanes: <i>(-)</i>—reaction control without DNA library; L—formamide ladder; T₁—limited hydrolysis by RNase T1. Selected guanine residues are labeled on the left. The short and long run of the gel is shown.</p

Helper antisense oligonucleotides and siRNAs against the 5’UTRcvb3 RNA.

<p>Helper antisense oligonucleotides and siRNAs against the 5’UTRcvb3 RNA.</p

Sites in the 5’UTRcvb3 RNA that are accessible for hybridization to complementary oligonucleotides.

<p>Thick grey lines indicate sites that were mapped as accessible in the secondary structure models proposed by Bailey and Tapprich (2007). Potential target sites for siRNAs are indicated by thin black lines along the structure. (A) The structure model of the 5' UTR of CV-B3 generated by comparative sequence analysis and energy minimization. (B) Experimentally validated structure model.</p

siRNA-induced silencing of the reporter construct hrGFP-5’UTRcvb3 in the absence and presence of helper oligomers.

<p>(A) Secondary structure model of the 5' UTR of CV-B3 according to Bailey and Tapprich (2007). Results of the <i>in vivo</i> structure probing are displayed on the model with the circles: black circle—strong DMS-induced A or C modification; empty circle—weak A or C modification. Thick gray lines indicate the target sites of helper 2’-O-methyl-16-mers (light gray) and siRNAs (dark gray). (B) Representative Western blot showing down regulation of the hrGFP-5’UTRcvb3 construct in HeLa cells. The cells were co-transfected with the combinations of 50 nM helper oligomers (name in italics) and 0.1 or 0.25 nM siRNA, respectively (name in black.: si162—siRNA_162, si213—siRNA_213, si420—siRNA_420), as indicated in the figure; GAPDH—loading control; hrGFP—reporter protein. Numbers under blots respect bars showed in graph in panel C. (C) Graph showing relative hrGFP band density normalized to GAPDH. Data were obtained in Western blots for 50 nM helper oligomers and 0.25 nM siRNA. Values are the averages from three independent experiments. Numbers under X axis respect lines showed in Western blot in panel B. The p-values were calculated using Student’s t-test for the following samples: Lanes 3:4, p = 0.062; lanes 6:7, p = 0.209; lanes 9:10, p = 0.756. (D) Graphs showing relative fluorescence intensity exhibited by HeLa cells co-transfected with oligomer combinations and a reporter fusion construct hrGFP-5’UTRcvb3, measured by plate reader. Components of the oligonucleotide mixture indicated in the figure as described above. The p-values were calculated using Student’s t-test for the following samples: 0.1 nM si162+<i>me_C</i>: 0.1 nM si162+<i>me_5</i>, p = 0.152; 0.1 nM si213+<i>me_C</i>: 0.1 nM si213+<i>me_8</i>, p = 0.147; 0.1 nM si420+<i>me_C</i>: 0.1 nM si420+<i>me_9</i>, p = 0.128; 0.25 nM si162+<i>me_C</i>: 0.1 nM si162+<i>me_5</i>, p = 0.679; 0.25 nM si213+<i>me_C</i>: 0.1 nM si213+<i>me_8</i>, p = 0.379; 0.25 nM si420+<i>me_C</i>: 0.1 nM si420+<i>me_9</i>, p = 0.451.</p