5 research outputs found
Transformers with Learnable Activation Functions
Activation functions can have a significant impact on reducing the
topological complexity of input data and therefore improve the performance of
the model. Selecting a suitable activation function is an essential step in
neural model design. However, the choice of activation function is seldom
discussed or explored in Transformer-based language models. Their activation
functions are chosen beforehand and then remain fixed from pre-training to
fine-tuning. As a result, the inductive biases they imposed on models cannot be
adjusted during this long life cycle. Moreover, subsequently developed models
(e.g., RoBERTa, BART, and GPT-3) often follow up prior work (e.g., BERT) to use
the same activation function without justification. In this paper, we
investigate the effectiveness of using Rational Activation Function (RAF), a
learnable activation function, in the Transformer architecture. In contrast to
conventional, predefined activation functions, RAFs can adaptively learn
optimal activation functions during training according to input data. Our
experiments show the RAF-based Transformer (RAFT) achieves a lower validation
perplexity than a vanilla BERT with the GELU function. We further evaluate RAFT
on downstream tasks in low- and full-data settings. Our results show that RAFT
outperforms the counterpart model across the majority of tasks and settings.
For instance, RAFT outperforms vanilla BERT on the GLUE benchmark by 5.71
points on average in low-data scenario (where 100 training examples are
available) and by 2.05 points on SQuAD in full-data setting. Analysis of the
shapes of learned RAFs further unveils that they substantially vary between
different layers of the pre-trained model and mostly look very different from
conventional activation functions. RAFT opens a new research direction for
analyzing and interpreting pre-trained models according to the learned
activation functions.Comment: Accepted by EACL2023 finding
Using Pan RNA-Seq Analysis to Reveal the Ubiquitous Existence of 5′ and 3′ End Small RNAs
In this study, we used pan RNA-seq analysis to reveal the ubiquitous existence of both 5′ and 3′ end small RNAs (5′ and 3′ sRNAs). 5′ and 3′ sRNAs alone can be used to annotate nuclear non-coding and mitochondrial genes at 1-bp resolution and identify new steady RNAs, which are usually transcribed from functional genes. Then, we provided a simple and cost effective way for the annotation of nuclear non-coding and mitochondrial genes and the identification of new steady RNAs, particularly long non-coding RNAs (lncRNAs). Using 5′ and 3′ sRNAs, the annotation of human mitochondrial was corrected and a novel ncRNA named non-coding mitochondrial RNA 1 (ncMT1) was reported for the first time in this study. We also found that most of human tRNA genes have downstream lncRNA genes as lncTRS-TGA1-1 and corrected the misunderstanding of them in previous studies. Using 5′, 3′, and intronic sRNAs, we reported for the first time that enzymatic double-stranded RNA (dsRNA) cleavage and RNA interference (RNAi) might be involved in the RNA degradation and gene expression regulation of U1 snRNA in human. We provided a different perspective on the regulation of gene expression in U1 snRNA. We also provided a novel view on cancer and virus-induced diseases, leading to find diagnostics or therapy targets from the ribonuclease III (RNase III) family and its related pathways. Our findings pave the way toward a rediscovery of dsRNA cleavage and RNAi, challenging classical theories
NormExpression: An R Package to Normalize Gene Expression Data Using Evaluated Methods
Data normalization is a crucial step in the gene expression analysis as it ensures the validity of its downstream analyses. Although many metrics have been designed to evaluate the existing normalization methods, different metrics or different datasets by the same metric yield inconsistent results, particularly for the single-cell RNA sequencing (scRNA-seq) data. The worst situations could be that one method evaluated as the best by one metric is evaluated as the poorest by another metric, or one method evaluated as the best using one dataset is evaluated as the poorest using another dataset. Here raises an open question: principles need to be established to guide the evaluation of normalization methods. In this study, we propose a principle that one normalization method evaluated as the best by one metric should also be evaluated as the best by another metric (the consistency of metrics) and one method evaluated as the best using scRNA-seq data should also be evaluated as the best using bulk RNA-seq data or microarray data (the consistency of datasets). Then, we designed a new metric named Area Under normalized CV threshold Curve (AUCVC) and applied it with another metric mSCC to evaluate 14 commonly used normalization methods using both scRNA-seq data and bulk RNA-seq data, satisfying the consistency of metrics and the consistency of datasets. Our findings paved the way to guide future studies in the normalization of gene expression data with its evaluation. The raw gene expression data, normalization methods, and evaluation metrics used in this study have been included in an R package named NormExpression. NormExpression provides a framework and a fast and simple way for researchers to select the best method for the normalization of their gene expression data based on the evaluation of different methods (particularly some data-driven methods or their own methods) in the principle of the consistency of metrics and the consistency of datasets
Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus
In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes