Hypofibrinolysis in diabetes: a therapeutic target for the reduction of cardiovascular risk

An enhanced thrombotic environment and premature atherosclerosis are key factors for the increased cardiovascular risk in diabetes. The occlusive vascular thrombus, formed secondary to interactions between platelets and coagulation proteins, is composed of a skeleton of fibrin fibres with cellular elements embedded in this network. Diabetes is characterised by quantitative and qualitative changes in coagulation proteins, which collectively increase resistance to fibrinolysis, consequently augmenting thrombosis risk. Current long-term therapies to prevent arterial occlusion in diabetes are focussed on anti-platelet agents, a strategy that fails to address the contribution of coagulation proteins to the enhanced thrombotic milieu. Moreover, antiplatelet treatment is associated with bleeding complications, particularly with newer agents and more aggressive combination therapies, questioning the safety of this approach. Therefore, to safely control thrombosis risk in diabetes, an alternative approach is required with the fibrin network representing a credible therapeutic target. In the current review, we address diabetes-specific mechanistic pathways responsible for hypofibrinolysis including the role of clot structure, defects in the fibrinolytic system and increased incorporation of anti-fibrinolytic proteins into the clot. Future anti-thrombotic therapeutic options are discussed with special emphasis on the potential advantages of modulating incorporation of the anti-fibrinolytic proteins into fibrin networks. This latter approach carries theoretical advantages, including specificity for diabetes, ability to target a particular protein with a possible favourable risk of bleeding. The development of alternative treatment strategies to better control residual thrombosis risk in diabetes will help to reduce vascular events, which remain the main cause of mortality in this condition

Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements

Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5′AAACATGTTT3′) and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5′AAACATGTTTTAAAACATGTTT3′). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer–dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded Kd = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability