The Brd gene family and the N pathway

Genomic DNA mapping Bob and Tom probes were hybridized successively to a filter array of Drosophila P1 genomic DNA clones (Genome Systems). The positive clones were found to be part of an overlapping set in the 71A1-2 region of the left arm of chromosome 3 (BDGP), the known cytological location of Brd Plasmid construction To create Brd family gene expression constructs, we used PCR to amplify the coding regions and 8-10 nt of 5′ UTR sequence (to provide translational initiation context) of Brd, E(spl)m4, Bob, Tom and E(spl)mα. PCR products containing upstream BamHI and downstream SalI sites were subcloned into pBluescript and fully sequenced. These fragments were then excised with BamHI and XhoI and cloned into the BglII and XhoI sites of the pUAST vector Germline transformation P element-mediated germline transformation was carried out as described by E. C. Lai and others 293 The Brd gene family and the N pathway DNA-binding assays GST-Su(H) fusion protein was purified as described by RNA duplex assays Wild-type (PB wt) and mutant (PB mut) proneural box-containing RNA probes derived from the ato 3′ UTR were constructed as follows. The following pairs of oligonucleotides were synthesized, annealed, filled in with Klenow fragment, and cloned into the EcoRV site of pBS+: PB wt: CCTAGCCTAAATGGAAGACAATGATTAAGACTAAGGAAGACAATGTAAAAGCACC ATCGGATTTACCTTCTGTTACTAATTCTGATTCCTTCTGTTACATTTTCGTGGGG PB mut

Reservoirs of resistance: polymyxin resistance in veterinary-associated companion animal isolates of Pseudomonas aeruginosa

is an opportunistic pathogen and a major cause of infections. Widespread resistance in human infections are increasing the use of last resort antimicrobials such as polymyxins. However, these have been used for decades in veterinary medicine. Companion animals are an understudied source of antimicrobial resistant isolates. This study evaluated the susceptibility of veterinary isolates to polymyxins to determine whether the veterinary niche represents a potential reservoir of resistance genes for pathogenic bacteria in both animals and humans.Clinical isolates (n=24) from UK companion animals were compared for antimicrobial susceptibility to a panel of human-associated isolates (n=37). Minimum inhibitory concentration (MIC) values for polymyxin B and colistin in the companion animals was significantly higher than in human isolates (P=0.033 and P=0.013, respectively). Genotyping revealed that the veterinary isolates were spread throughout the population, with shared array types from human infections such as keratitis and respiratory infections, suggesting the potential for zoonotic transmission. Whole genome sequencing revealed mutations in genes associated with polymyxin resistance and other antimicrobial resistance-related genes.The high levels of resistance to polymyxin shown here, along with genetic similarities between some human and animal isolates, together suggest a need for sustained surveillance of this veterinary niche as a potential reservoir for resistant, clinically relevant bacteria in both animals and humans