269 research outputs found
Ionsko-akustični solitoni u slabo-relativističkoj plazmi s hladnim ionima i dvotemperaturnim elektronima
Propagation of a finite-amplitude ion-acoustic solitary wave in a weakly-relativistic plasma consisting of cold ions and warm electrons of two different temperatures have been studied analytically. Sufficient and necessary conditions for the existence of ion-acoustic solitons in such a plasma are obtained from which it is observed that both the relativistic effect and the two-temperature electrons have important role for the formation of the soliton. Critical values for the soliton amplitude and its velocity are numerically estimated for different values of the concentration of two-temperature electrons and relativistic stream velocity.Analitički se proučava širenje ionsko-akustičnog solitonskog vala u slabo relativističkoj plazmi koja se sastoji od hladnih iona i vrućih elektrona na dvije temperature. Izvode se nužni i dovoljni uvjeti za postojanje ionsko-akustičnog solitona koji pokazuju važnost kako relativističkih efekata, tako i dviju elektronskih temperatura. Kritične vrijednosti solitonske amplitude i brzine ocijenjuju se numerički za niz vrijednosti koncentracije dvotemperaturnih elektrona i relativističke brzine strujanja
Multi-objective fully intuitionistic fuzzy fixed-charge solid transportation problem
During past few decades, fuzzy decision is an important attention in the areas of science, engineering, economic system,
business, etc. To solve day-to-day problem, researchers use fuzzy data in transportation problem for presenting the uncontrollable
factors; and most of multi-objective transportation problems are solved using goal programming. However, when the
problem contains interval-valued data, then the obtained solution was provided by goal programming may not satisfy by all
decision-makers. In such condition, we consider a fixed-charge solid transportation problem in multi-objective environment
where all the data are intuitionistic fuzzy numbers with membership and non-membership function. The intuitionistic fuzzy
transportation problem transforms into interval-valued problem using (α, β)-cut, and thereafter, it reduces into a deterministic
problem using accuracy function. Also the optimum value of alternative corresponds to the optimum value of accuracy
function. A numerical example is included to illustrate the usefulness of our proposed model. Finally, conclusions and future
works with the study are described.Portuguese Foundation for Science and Technology ("FCT-Fundacao para a Ciencia e a Tecnologia"), through the CIDMA-Center for Research and Development in Mathematics and Applications
UID/MAT/ 04106/2019Spanish Ministry of Economy and Competitiveness, FEDER funds from the European Union
TIN2014-55024-P
TIN2017-86647-
Species specific mitochondrial Cytochrome c oxidase gene sequence of Manipuri pony
The Manipuri pony, a unique indigenous horse breed of India, is known for its fastness, intelligence, surefooted moves and high endurance. The use of DNA barcodes, short DNA sequences from a standardized region of the mitochondrial (mt) genome, has recently been proposed as a tool to facilitate species identification. However, for this emblematic species, there is lacking in the development of DNA barcode which will remain as the molecular tag in the future. A specific molecular identification tag of Manipuri pony was developed under the Accession no. JN228963, and analysis within this family found that the individuals of a single species grouped closely together. Using a set of primer (forward-5´CCAACCACAAAGACATTGGCAC 3´ and reverse- 5´ CTTCTGGGTGGCAA AGAATCA 3´), PCR amplification based on the total genomic DNA extracted from hair samples of Manipuri pony gave an amplification product of 669bp which lies within the barcode region of COI gene of the mitochondrial genome. The partial sequence of COI gene, which is the DNA barcode of Manipuri pony will remain as the molecular identification mark for this species in the future. Additionally, it will also enhance the conservation of genetic resources of Manipuri pony. COI sequence divergence for conspecific individuals of Equidae family was 0.46%, whereas those for congeneric species averaged 6.75% (3.3% to 9.5%). The present finding reaffirmed a very close genetic similarity among the Equidae species. The results showed that analysis based on mt COI gene can be useful for explaining the phylogenetic relationships in the family Equidae
Green synthesized silver nanoparticles destroy multidrug resistant bacteria via reactive oxygen species mediated membrane damage
AbstractThe growing need of antimicrobial agent for novel therapies against multi-drug resistant bacteria has drawn researchers to green nanotechnology. Especially, eco-friendly biosynthesis of silver nanoparticles (Ag NPs) has shown its interesting impact against bacterial infection in laboratory research. In this study, a simple method was developed to form Ag NPs at room temperature, bio-reduction of silver ions from silver nitrate salt by leaf extract from Ocimum gratissimum. The Ag NPs appear to be capped with plant proteins, but are otherwise highly crystalline and pure. The Ag NPs have a zeta potential of −15mV, a hydrodynamic diameter of 31nm with polydispersity index of 0.65, and dry sizes of 18±3nm and 16±2nm, based on scanning and transmission electron microscopy respectively. The minimum inhibitory concentration (MIC) of the Ag NPs against a multi-drug resistant Escherichia coli was 4μg/mL and the minimum bactericidal concentration (MBC) was 8μg/mL, while the MIC and MBC against a resistant strain of Staphylococcus aureus were slightly higher at 8μg/mL and 16μg/mL respectively. Further, the Ag NPs inhibited biofilm formation by both Escherichia coli and S. aureus at concentrations similar to the MIC for each strain. Treatment of E. coli and S. aureus with Ag NPs resulted in damage to the surface of the cells and the production of reactive oxygen species. Both mechanisms likely contribute to bacterial cell death. In summary, this new method appears promising for green biosynthesis of pure Ag NPs with potent antimicrobial activity
Characterization of acaricide resistance in tick isolates collected from Rajasthan, India
Rhipicephalus (Boophilus) microplus and Hyalomma anatolicum are the most common tick species infesting milk and meat producing animals throughout the country. The present study was conducted to evaluate the acaricide resistance status of the tick species to deltamethrin, cypermethrin, diazinon collected from 10 districts of Rajasthan. Characterization of resistance was carried out by adult immersion test (AIT) and larval packet test (LPT). In case of (B.) microplus resistance to deltamethrin at level I (RF = 2.5 – 4.9) in 02 isolates, at level II in 03 isolates (RF = 5.4 – 11.5) and level IV in 02 isolates (RF = 48.1 – 95.7) was detected. The resistance to cypermethrin was detected in 08 isolates of which resistance at level I in 03 isolates (RF = 2.7 - 4.58) and at level II in 05 isolates (RF = 8.05 – 16.2). Diazinon resistance was detected at level II in 06 isolates (RF = 5.8 –22.8), at level III in 01 isolates (RF = 39.0) and level IV in 02 isolates (RF = 65.9 – 66.0). While in case of H. anatolicum, the resistance to deltamethrin at level I (RF = 1.79 –2.52) in 03 isolates, to cypermethrin in 03 isolates (RF= 2.0 - 3.95) and to diazinon at level I in 03 isolates (RF = 1.32 –2.18) out of eleven isolates was detected.
A significant correlation between esterase enzyme ratio and resistant factor of tick isolates was observed with correlation coefficient (r) in α- and ß-esterase activity. The coefficient of determination (R2) for α- and ß-esterase activity indicated that 55.9 and 50.5% data points of R.(B.) microplus isolates and 66.7 and 47.2% data points of H. anatolicum isolates were very close to the correlation lines.
Analysis of sequence data of 3 targeted positions of the sodium channel gene detected a cytosine (C) to adenine (A) nucleotide substitution (CTC to ATC) at position 190 in domain II S4–5 linker region of para-sodium channel gene in 3 isolates and in reference deltamethrin resistant IVRI-IV line.
The western dry region and central plateau hills region revealed higher density of resistant ticks where intensive crossbred cattle population are reared and synthetic pyrethroids and organophosphate compounds are commonly used. The data shows an urgent need of revisiting the tick control strategy implemented through concerned government/non-government agencies
Physics Potential of the ICAL detector at the India-based Neutrino Observatory (INO)
The upcoming 50 kt magnetized iron calorimeter (ICAL) detector at the
India-based Neutrino Observatory (INO) is designed to study the atmospheric
neutrinos and antineutrinos separately over a wide range of energies and path
lengths. The primary focus of this experiment is to explore the Earth matter
effects by observing the energy and zenith angle dependence of the atmospheric
neutrinos in the multi-GeV range. This study will be crucial to address some of
the outstanding issues in neutrino oscillation physics, including the
fundamental issue of neutrino mass hierarchy. In this document, we present the
physics potential of the detector as obtained from realistic detector
simulations. We describe the simulation framework, the neutrino interactions in
the detector, and the expected response of the detector to particles traversing
it. The ICAL detector can determine the energy and direction of the muons to a
high precision, and in addition, its sensitivity to multi-GeV hadrons increases
its physics reach substantially. Its charge identification capability, and
hence its ability to distinguish neutrinos from antineutrinos, makes it an
efficient detector for determining the neutrino mass hierarchy. In this report,
we outline the analyses carried out for the determination of neutrino mass
hierarchy and precision measurements of atmospheric neutrino mixing parameters
at ICAL, and give the expected physics reach of the detector with 10 years of
runtime. We also explore the potential of ICAL for probing new physics
scenarios like CPT violation and the presence of magnetic monopoles.Comment: 139 pages, Physics White Paper of the ICAL (INO) Collaboration,
Contents identical with the version published in Pramana - J. Physic
Genetics of randomly bred cats support the cradle of cat domestication being in the Near East
Cat domestication likely initiated as a symbiotic relationship between wildcats (Felis silvestris subspecies) and the peoples of developing agrarian societies in the Fertile Crescent. As humans transitioned from hunter-gatherers to farmers ~12,000 years ago, bold wildcats likely capitalized on increased prey density (i.e., rodents). Humans benefited from the cats’ predation on these vermin. To refine the site(s) of cat domestication, over 1000 random-bred cats of primarily Eurasian descent were genotyped for single-nucleotide variants and short tandem repeats. The overall cat population structure suggested a single worldwide population with significant isolation by the distance of peripheral subpopulations. The cat population heterozygosity decreased as genetic distance from the proposed cat progenitor’s (F.s. lybica) natural habitat increased. Domestic cat origins are focused in the eastern Mediterranean Basin, spreading to nearby islands, and southernly via the Levantine coast into the Nile Valley. Cat population diversity supports the migration patterns of humans and other symbiotic species
Air pollution from household solid fuel combustion in India: an overview of exposure and health related information to inform health research priorities
Environmental and occupational risk factors contribute to nearly 40% of the national burden of disease in India, with air pollution in the indoor and outdoor environment ranking amongst leading risk factors. It is now recognized that the health burden from air pollution exposures that primarily occur in the rural indoors, from pollutants released during the incomplete combustion of solid fuels in households, may rival or even exceed the burden attributable to urban outdoor exposures. Few environmental epidemiological efforts have been devoted to this setting, however. We provide an overview of important available information on exposures and health effects related to household solid fuel use in India, with a view to inform health research priorities for household air pollution and facilitate being able to address air pollution within an integrated rural–urban framework in the future
- …