Important Protozoan Parasites In Indonesia

The most important protozoan parasites in Indonesia are the malaria parasites, Toxoplasma gondii and Entamoeba histolytica. After the second world war the residual insecticides and effective antimalarial drugs were used in the control of malaria. After development of resistance among mosquitoes to insecticides, the Malaria Control Programme was switched over to the Malaria Eradication Programme. Malaria incidence dropped heavily. However, due to the quick development of vector resistance and financial limitations, malaria came back and so did the Malaria Control Programme. P. falciparum and P.vivax are the most common species in Indonesia. Important vectors are An. sundaicus, An. aconitus, An. maculatus, An. hyrcanus group, An. balabacensis, An. farauti etc. An. sundaicus and An. aconitus have developed resistance to DDT and Dieldrin in Java. In 1959 the Malaria Eradication Programme was started in Java, Bali and Lampung. In 1965 the API dropped to 0,15 per thousand. From 1966 onwards malaria transmission was on the increase, because spraying activities were slowed down, but dropped again from 1974 onwards by occasional residual house spraying with DDT or Fenitrothion, malaria surveillance and treatment of malaria cases, resulting in an API of 0.18 per thousand in 1987. At present malaria is not transmitted in Jakarta and in capitals of the provinces and kabupatens, except in Irian Jaya, Nusa Tenggara Timur and one or two other provinces, but it still exists in rural areas. The distribution of chloroquine resistant P.falciparum is patchy. Resistance is at the RI, RII and RUT levels. The main problems of malaria control are : the increasing development of resistance of the vector to insecticides, the change of An.aconitus from zoophili to anthropophili and from indoor to outdoor biting, the increasing resistance of P.falciparum to chloroquine, the shortage of skilled manpower and limitation of budget. In Indonesia many newborns with congenital anomalies are found. T. gondii as one of the causes, is widely spread in man and animals. The prevalence of Toxoplasma antibodies in man varies from 2 % to 63 %, in cats and other animals it can reach up to 75%. Confirmed cases of congenital toxoplasmosis are reported. The diagnosis of toxoplasmosis in the Department of Parasitology, University of Indonesia is done with detection of specific IgM and IgG antibodies with ELISA. A test for antigenemia to get a rapid and direct diagnosis of active infection is not yet available. A suitable Toxoplasma vaccine to prevent toxoplasmosis would be desirable. E. histolytica infection is endemic throughout the archipelago. The prevalence rates are 18% to 25% . Extraintestinal infection mostly occurs in the liver. Pulmonary amebiasis is occasionally found. Medication with metronidazole has obtained good results. Diagnosis of extraintestinal amebiasis in our laboratory is by the immunodiffusion test, which is not capable to differentiate active infection from infection in the past. A more accurate diagnosis would be the use of monoclonal antibodies to detect antigens

Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia