Experimental Approach for Bacterial Strains Characterization

In plant biology, data acquisition is no longer necessarily a major problem but nevertheless the treatment and the use of these data are still difficult. In this work, we are particularly interested by the characterization of strains of phytopathogenic bacterias, which is an important issue in the study of plant diseases. We study and compare several methods computing the smallest possible characterizations. These experiments have allowed us to characterize specific strains and diagnosis tests have been produced and used

The bacterial strains characterization problem

The accurate characterization of collections of bacterial strains is a major scientific challenge, since bacteria are indeed responsible of significant plant diseases and thus subjected to official control procedures (e.g., in Europe, Directive 2000/29/EC). The development of diagnostic tests is therefore an important issue in order to routinely identify strains of these species

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

Phenoplant: a web resource for the exploration of large chlorophyll fluorescence image datasets

Background Image analysis is increasingly used in plant phenotyping. Among the various imaging techniques that can be used in plant phenotyping, chlorophyll fluorescence imaging allows imaging of the impact of biotic or abiotic stresses on leaves. Numerous chlorophyll fluorescence parameters may be measured or calculated, but only a few can produce a contrast in a given condition. Therefore, automated procedures that help screening chlorophyll fluorescence image datasets are needed, especially in the perspective of high-throughput plant phenotyping. Results We developed an automatic procedure aiming at facilitating the identification of chlorophyll fluorescence parameters impacted on leaves by a stress. First, for each chlorophyll fluorescence parameter, the procedure provides an overview of the data by automatically creating contact sheets of images and/or histograms. Such contact sheets enable a fast comparison of the impact on leaves of various treatments, or of the contrast dynamics during the experiments. Second, based on the global intensity of each chlorophyll fluorescence parameter, the procedure automatically produces radial plots and box plots allowing the user to identify chlorophyll fluorescence parameters that discriminate between treatments. Moreover, basic statistical analysis is automatically generated. Third, for each chlorophyll fluorescence parameter the procedure automatically performs a clustering analysis based on the histograms. This analysis clusters images of plants according to their health status. We applied this procedure to monitor the impact of the inoculation of the root parasitic plant Phelipanche ramosa on Arabidopsis thaliana ecotypes Col-0 and Ler. Conclusions Using this automatic procedure, we identified eight chlorophyll fluorescence parameters discriminating between the two ecotypes of A. thaliana, and five impacted by the infection of Arabidopsis thaliana by P. ramosa. More generally, this procedure may help to identify chlorophyll fluorescence parameters impacted by various types of stresses. We implemented this procedure at http://www.phenoplant.org webcite freely accessible to users of the plant phenotyping community

Inner necrosis in grapevine rootstock mother plants in the Cognac area (Charentes, France)

The incidence and quantification of decline-associated inner necrosis in grapevine rootstock mother plants have rarely been studied. In an experimental vineyard planted in 1991 at Saintes (Charentes), susceptibility to esca was evaluated in eleven common rootstock varieties. Fifty vines per rootstock variety were used as mother plants producing long canes which were severely pruned every year. No foliar symptoms, typical of grapevine wood diseases, were seen in field inspections conducted in the summer of 1996, 2002, 2003 and 2006. In 2007, nine trunks per variety were randomly selected and were cross-sectioned at the point of greatest diameter. All sections revealed typical esca necrosis, central and/or sector-shaped, indicating that such necrosis is very common. Every section was photographed and the percentage of necrotic area was calculated by either visual assessment or image-analysis. No significant difference was detected between these two calculating methods. Based on the mean percent necrotic area, rootstock varieties were ranked in order of susceptibility from the least susceptible, ‘1103 Paulsen’ (33%), to the most susceptible, ‘101-14 MGT’ (71%). The percent of necrotic area was correlated significantly with i) the incidence of mortality and ii) the percentage of vine sections showing white rot, a type of necrosis indicating an advanced stage of wood deterioration. This study confirmed that necrosis in grapevine wood is not always associated with foliar symptoms, but that it is related positively with grapevine mortality. Furthermore, wood necrosis in mother-plants poses a risk of disseminating associated fungi through propagation material

A multiplex-PCR assay for identification of the quarantine plant pathogen Xanthomonas axonopodis pv. phaseoli

In this study we developed an algorithm to screen for all exact molecular signatures of the quarantine pathogen Xanthomonas axonopodis pv. phaseoli (Xap), based on available data of the presence or absence of virulence-associated genes. The simultaneous presence of genes avrBsT and xopL is specific to Xap. Therefore we developed a multiplex PCR assay targeting avrBsT and xopL for the molecular identification of Xap. The specificity of this multiplex was validated by comparison to that of other molecular identification assays aimed at Xap, on a wide collection of reference strains. This multiplex was further validated on a blind collection of Xanthomonas isolates for which pathogenicity was assayed by stem wounding and by dipping leaves into calibrated inocula. This multiplex was combined to the previously described X4c/X4e molecular identification assay for Xap. Such a combination enables the molecular identification of all strains of Xanthomonas pathogenic on bean. Results also show that assay by stem wounding does not give reliable results in the case of Xap, and that pathogenicity assays by dipping should be preferred