Equine degenerative myeloencephalopathy: prevalence, impact, and management.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy is an inherited neurodegenerative disorder affecting many horse breeds. Clinical signs include a symmetric ataxia and an abnormal stance at rest, similar to cervical vertebral compressive myelopathy, equine protozoal myeloencephalitis, and equine herpesvirus 1 myeloencephalopathy. This review will provide an update on the disease prevalence, management, impact, and ongoing research

Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era.

The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromere research. Despite extremely low genetic diversity of the Y chromosome, it has been possible to trace patrilines of breeds and pedigrees and show that Y variation was lost in the past approximately 2300 years owing to selective breeding. The high-quality reference genome has led to the development of three different SNP arrays and WGSs of almost 2000 modern individual horses. The collection of WGS of hundreds of ancient horses is unique and not available for any other domestic species. These tools and resources have led to global population studies dissecting the natural history of the species and genetic makeup and ancestry of modern breeds. Most importantly, the available tools and resources, together with the discovery of functional elements, are dissecting molecular causes of a growing number of Mendelian and complex traits. The improved understanding of molecular underpinnings of various traits continues to benefit the health and performance of the horse whereas also serving as a model for complex disease across species

Vitamin E depletion is associated with subclinical axonal degeneration in juvenile horses

BackgroundPhosphorylated neurofilament heavy, a marker of neuroaxonal damage, is increased in horses with equine neuroaxonal dystrophy. However, the temporal dynamics of this biomarker during the post-natal risk period are not understood.ObjectiveTo measure serum and cerebrospinal fluid phosphorylated neurofilament heavy concentrations in juvenile foals across the post-natal window of susceptibility for equine neuroaxonal dystrophy.Study designCase-control in vivo experimental study.MethodsConcentrations of phosphorylated neurofilament heavy were measured using frozen serum and cerebrospinal fluid collected from 13 foals raised in a vitamin E deficient environment from 1 to 6 months of age. Four of these foals were produced by equine neuroaxonal dystrophy-affected dams, developed clinical signs consistent with equine neuroaxonal dystrophy and had a diagnosis confirmed by histopathology. The remaining nine foals, produced by healthy mares, were vitamin E depleted and remained clinically healthy. An additional cohort of foals, produced by healthy mares, were supplemented with vitamin E (α-tocopherol; α-TOH) from birth and sampled similarly.ResultsSerum α-TOH concentrations were significantly higher in vitamin E supplemented healthy foals. Serum phosphorylated neurofilament heavy concentrations did not differ significantly between groups at any time point. Cerebrospinal fluid phosphorylated neurofilament heavy concentrations increased with age in healthy vitamin E depleted foals (p < 0.001); an effect that was not observed in healthy vitamin E supplemented foals.Main limitationsA genetically susceptible cohort supplemented with vitamin E was not available for comparison.ConclusionWe demonstrate that vitamin E depletion may elevate cerebrospinal fluid phosphorylated neurofilament heavy in otherwise healthy juvenile foals by 6 months of age. We highlight an important cofactor to consider when interpreting cerebrospinal fluid phosphorylated neurofilament heavy concentrations in juvenile horses

Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses

Major Histocompatibility Complex I and II Expression and Lymphocytic Subtypes in Muscle of Horses with Immune-Mediated Myositis.

BackgroundMajor histocompatibility complex (MHC) I and II expression is not normally detected on sarcolemma, but is detected with lymphocytic infiltrates in immune-mediated myositis (IMM) of humans and dogs and in dysferlin-deficient muscular dystrophy.Hypothesis/objectivesTo determine if sarcolemmal MHC is expressed in active IMM in horses, if MHC expression is associated with lymphocytic subtype, and if dysferlin is expressed in IMM.AnimalsTwenty-one IMM horses of Quarter Horse-related breeds, 3 healthy and 6 disease controls (3 pasture myopathy, 3 amylase-resistant polysaccharide storage myopathy [PSSM]).MethodsImmunohistochemical staining for MHC I, II, and CD4+, CD8+, CD20+ lymphocytes was performed on archived muscle of IMM and control horses. Scores were given for MHC I, II, and lymphocytic subtypes. Immunofluorescent staining for dysferlin, dystrophin, and a-sarcoglycan was performed.ResultsSarcolemmal MHC I and II expression was detected in 17/21 and 15/21 of IMM horses, respectively, and in specific fibers of PSSM horses, but not healthy or pasture myopathy controls. The CD4+, CD8+, and CD20+ cells were present in 20/21 IMM muscles with CD4+ predominance in 10/21 and CD8+ predominance in 6/21 of IMM horses. Dysferlin, dystrophin, and a-sarcoglycan staining were similar in IMM and control muscles.Conclusions and clinical importanceDeficiencies of dysferlin, dystrophin, and a-sarcoglycan are not associated with IMM. Sarcolemmal MHC I and II expression in a proportion of myofibers of IMM horses in conjunction with lymphocytic infiltration supports an immune-mediated etiology for IMM. The MHC expression also occured in specific myofibers in PSSM horses in the absence of lymphocytic infiltrates

Prevalence of the E321G MYH1 variant for immune-mediated myositis and nonexertional rhabdomyolysis in performance subgroups of American Quarter Horses.

BackgroundImmune-mediated myositis (IMM) in American Quarter Horses (QHs) causes acute muscle atrophy and lymphocytic infiltration of myofibers. Recently, an E321G mutation in a highly conserved region of the myosin heavy chain 1 (MYH1) gene was associated with susceptibility to IMM and nonexertional rhabdomyolysis.ObjectivesTo estimate prevalence of the E321G MYH1 variant in the QH breed and performance subgroups.AnimalsThree-hundred seven elite performance QHs and 146 random registered QH controls.MethodsProspective genetic survey. Elite QHs from barrel racing, cutting, halter, racing, reining, Western Pleasure, and working cow disciplines and randomly selected registered QHs were genotyped for the E321G MYH1 variant and allele frequencies were calculated.ResultsThe E321G MYH1 variant allele frequency was 0.034 ± 0.011 in the general QH population (6.8% of individuals in the breed) and the highest among the reining (0.135 ± 0.040; 24.3% of reiners), working cow (0.085 ± 0.031), and halter (0.080 ± 0.027) performance subgroups. The E321G MYH1 variant was present in cutting (0.044 ± 0.022) and Western Pleasure (0.021 ± 0.015) QHs at lower frequency and was not observed in barrel racing or racing QHs.Conclusions and clinical importanceKnowing that reining and working cow QHs have the highest prevalence of the E321G MYH1 variant and that the variant is more prevalent than the alleles for hereditary equine regional dermal asthenia and hyperkalemic periodic paralysis in the general QH population will guide the use of genetic testing for diagnostic and breeding purposes

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Ground Response to Sheet Pile Installation in Clay

The effects of sheet pile installation on an adjacent cohesive soil mass are described herein. Observations indicate that driving sheet pile caused pore pressures to double at some locations. These pore pressures extended further than reported in previous studies concerning driven piles. Initially pore pressures rapidly dropped, but dissipation slowed after this initial adjustment. Inclinometer and extensometer data indicate that the clay was laterally displaced up and away from the sheeting causing the ground surface to heave. The impact of this behavior on subsequent stress changes during excavation is discussed