Equine degenerative myeloencephalopathy: prevalence, impact, and management.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy is an inherited neurodegenerative disorder affecting many horse breeds. Clinical signs include a symmetric ataxia and an abnormal stance at rest, similar to cervical vertebral compressive myelopathy, equine protozoal myeloencephalitis, and equine herpesvirus 1 myeloencephalopathy. This review will provide an update on the disease prevalence, management, impact, and ongoing research

Investigation of Known Genetic Mutations of Arabian Horses in Egyptian Arabian Foals with Juvenile Idiopathic Epilepsy.

BackgroundThe carrier status of lavender foal syndrome (LFS), cerebellar abiotrophy (CA), severe combined immunodeficiency (SCID), and occipitoatlantoaxial malformation (OAAM1) in foals with juvenile idiopathic epilepsy (JIE) is unknown.Hypothesis/objectivesTo determine the carrier status of LFS, CA, SCID, and OAAM1 in foals with JIE.AnimalsTen foals with JIE.Materials and methodsArchived DNA samples were tested for known genetic mutations causing LFS, CA, SCID, and OAAM1. The inclusion criteria consisted of having been diagnosed with JIE by ruling out other causes of seizures in foals and supported by electroencephalographic examination.ResultsTen Egyptian Arabian horses (5 females and 5 males) were phenotyped as foals with JIE by electroencephalography (EEG). All foals were negative for the genetic mutations that cause LFS, CA, SCID, and OAAM1 except for 1 foal that was a carrier of CA.Conclusions and clinical importanceJuvenile idiopathic epilepsy of Egyptian Arabian foals and LFS appear to be phenotypically and genetically distinct disorders. There was no apparent association between JIE and LFS, CA, SCID, and OAAM1

Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era.

The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromere research. Despite extremely low genetic diversity of the Y chromosome, it has been possible to trace patrilines of breeds and pedigrees and show that Y variation was lost in the past approximately 2300 years owing to selective breeding. The high-quality reference genome has led to the development of three different SNP arrays and WGSs of almost 2000 modern individual horses. The collection of WGS of hundreds of ancient horses is unique and not available for any other domestic species. These tools and resources have led to global population studies dissecting the natural history of the species and genetic makeup and ancestry of modern breeds. Most importantly, the available tools and resources, together with the discovery of functional elements, are dissecting molecular causes of a growing number of Mendelian and complex traits. The improved understanding of molecular underpinnings of various traits continues to benefit the health and performance of the horse whereas also serving as a model for complex disease across species

Strengthening Border Families: Community and Policy Responses to Serving Immigrant Families with Young Children in Doña Ana County, NM

This report details the results and recommendations of the first phase of a community-based participatory research project which aimed to explore the accessibility and quality of services as well as barriers and facilitators to service receipt among immigrant families with young children in the New Mexico borderlands

Strengthening Border Families: Data Highlights from Interviews & Focus Groups With Immigrant Caregivers

This report details key findings of the third phase of a multiphase mixed-methods study that aims to: 1) understand the accessibility and quality of services for immigrant families with young children in Doña Ana County both before and during the COVID-19 pandemic; 2) identify barriers and facilitators to service access for these families; and 3) uplift community-informed practice and policy solutions to improve equity in access to key supportive services for immigrant families with young children in southern New Mexico and across the state

Warmblood fragile foal syndrome type 1 mutation (PLOD1 c.2032G>A) is not associated with catastrophic breakdown and has a low allele frequency in the Thoroughbred breed.

BackgroundCatastrophic fractures are among the most common cause of fatalities in racehorses. Several factors, including genetics, likely contribute to increased risk for fatal injuries. A variant in the procollagen-lysine, 2-oxoglutarate 5-dioxygenase1 gene (PLOD1 c.2032G>A) was shown to cause Warmblood fragile foal syndrome type 1 (WFFS), a fatal recessive defect of the connective tissue. Screening of multiple horse breeds identified the presence of the WFFS allele in the Thoroughbred. PLOD1 is involved in cross-linking of collagen fibrils and thus could potentially increase the risk of catastrophic breakdown.ObjectivesEstimate the frequency of the WFFS allele (PLOD1 c.2032G>A) and determine if it is a risk factor for catastrophic breakdown in the Thoroughbred.Study designCase-control genetic study.MethodsGenomic DNA from hair and/or tissue samples was genotyped for the WFFS allele. Fisher's Exact tests were performed to compare allele and carrier frequencies between the case cohort (catastrophic breakdown, n = 22) and several cohorts with no record of injury (n = 138 raced/trained at same track and season and n = 185 older than 7 years and raced during same season), nonracers (n = 92), and a random sample without consideration for racing history (n = 279).ResultsThe frequency of the PLOD1 c.2032G>A variant in the Thoroughbred breed is low (1.2%). Seventeen of 716 Thoroughbreds tested were carriers (2.4%) and no WFFS homozygotes were detected. Only one catastrophic breakdown case carried the WFFS allele. No statistically significant difference in allele or carrier frequency was identified between case and control cohorts (P>0.05 in all comparisons performed).Main limitationsThis study evaluated cases from one single track.ConclusionsThis study demonstrated that the PLOD1 c.2032G>A associated with WFFS is present at very low frequency in Thoroughbreds and is not a genetic risk factor for catastrophic breakdown

Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses

Major Histocompatibility Complex I and II Expression and Lymphocytic Subtypes in Muscle of Horses with Immune-Mediated Myositis.

BackgroundMajor histocompatibility complex (MHC) I and II expression is not normally detected on sarcolemma, but is detected with lymphocytic infiltrates in immune-mediated myositis (IMM) of humans and dogs and in dysferlin-deficient muscular dystrophy.Hypothesis/objectivesTo determine if sarcolemmal MHC is expressed in active IMM in horses, if MHC expression is associated with lymphocytic subtype, and if dysferlin is expressed in IMM.AnimalsTwenty-one IMM horses of Quarter Horse-related breeds, 3 healthy and 6 disease controls (3 pasture myopathy, 3 amylase-resistant polysaccharide storage myopathy [PSSM]).MethodsImmunohistochemical staining for MHC I, II, and CD4+, CD8+, CD20+ lymphocytes was performed on archived muscle of IMM and control horses. Scores were given for MHC I, II, and lymphocytic subtypes. Immunofluorescent staining for dysferlin, dystrophin, and a-sarcoglycan was performed.ResultsSarcolemmal MHC I and II expression was detected in 17/21 and 15/21 of IMM horses, respectively, and in specific fibers of PSSM horses, but not healthy or pasture myopathy controls. The CD4+, CD8+, and CD20+ cells were present in 20/21 IMM muscles with CD4+ predominance in 10/21 and CD8+ predominance in 6/21 of IMM horses. Dysferlin, dystrophin, and a-sarcoglycan staining were similar in IMM and control muscles.Conclusions and clinical importanceDeficiencies of dysferlin, dystrophin, and a-sarcoglycan are not associated with IMM. Sarcolemmal MHC I and II expression in a proportion of myofibers of IMM horses in conjunction with lymphocytic infiltration supports an immune-mediated etiology for IMM. The MHC expression also occured in specific myofibers in PSSM horses in the absence of lymphocytic infiltrates

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed