Viability assessment of in vitro produced synthetic seeds of cucumber

Friable, embryogenic calli of F1 cucumber (Cucumis sativus) cultivar, Royal, were induced from the hypocotyl pieces cultured on solidified MS-basal media supplemented with 2,4-dichlorophenoxy acetic acid (2,4-D) and benzyl amino purine (BAP). Embryogenic calli were transferred to liquid Murashige and Skoog (MS)-basal  media supplemented with 5 ƒÊM naphthaleneacetic acid (NAA) and 1 µM BAP. The mature somatic embryos  were encapsulated in sodium alginate mixture in synthetic seeds. The encapsulation mixture containing 3%  sodium alginate, 100 mM calcium chloride and one-fourth volume of the cell suspension nutrient mixture  containing 5x10-4 somatic embryos per ml was found the best. Synthetic seeds remain viable up to 14 weeks  when stored at 4°C. Germination efficiency of synthetic seeds was decreased to 57% after 10 weeks of  storage followed by rapid decrease in survival rate to 0% after 15 weeks. Genetic diversity between mother  plants and in vitro produced synthetic seeds showed resemblance as assessed by amplified fragment length polymorphism (AFLP) markers.Key words: Artificial seed, Cucumis sativus, encapsulation, somatic embryogenesis, sodium-calcium alginate

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei

Trackable CEMB-Klean Cotton Transgenic Technology: Affordable Climate Neutral Agri-biotech Industrialization for Developing Countries

Background: Transgenic technology reflects the incorporation of novel useful traits in crop plants like cotton for economic benefits by overcoming the problems including insects’ pests and weeds in special. The present study is the success story of the continuous effort of CEMB team started back in the 1990s.Methods: This study includes characterization of a large number of Bacillus thuringiensis (Bt) strains taken from local soil and subjected to direct transformation of isolated BT genes into local cotton cultivars. Protocols for transformation into cotton plants were optimized and validated by the development of double gene codon optimized (Cry1Ac and Cry2A) transgenic cotton varieties.Results: The resulting GMOs in the form of CEMB-33, CA-12, CEMB-66 have been approved by Punjab Seed Council in 2013 and 2016 respectively. Double Bt and weedicide resistant cotton harboring CEMB-Modified and codon optimized cp4EPSPS (GTGene). These varieties can tolerate glyphosate spray @ 1900ml per acre without the appearance of necrotic spots/shedding and complete removal of all surrounding weeds in the cotton field is a significant advance to boost cotton production without spending much on insecticides and herbicides.Conclusion: In the current report, two unique sets of primers which amplify 1.1 Kb for CEMB-double Bt genes and 660 bp product for CEMB-Modified cp4EPSPS (GTGene) were tested. CEMB cotton variety CKC-01 is specially designed as low cost and easy to use by local farmer’s technology has the potential to revolutionize the cotton growing culture of the country.Keywords: Event detection; Bt Cotton; CEMB transgenic technology; GTGen

Indigenous Curd as a Functional Food: A Source of Potential Pathogenic Bacterial Control

Background: Dahi is a functional food that is largely consumed in our community.  The current study was designed to explore the efficacy of antibacterial agents that are present in the local indigenous curd of Lahore, Pakistan.Method: Dahi was collected from various areas in Lahore. Bacterial cultures were isolated from this local curd and identified using a molecular technique that used 16S rRNA gene primers in PCR and sequencing. The antibacterial assay was carried out using the agar well diffusion method. Out of all the characterized bacteria isolate P26 displayed the best results for the control of pathogenic bacteria. Bacteriocin from isolate P26 was partially purified and its antibacterial assay was performed against sixteen indicator organisms and kanamycin was used as a standard for this experiment. Characterization of bacteriocin was performed at various temperatures, pH, and treating with enzymes.Result: After the molecular characterization through 16S rRNA, Strain P26 was characterized as Bacillus vallismortis. A protease-sensitive antimicrobial substance was produced by Bacterial strain P26 (Bacillus vallismortis), isolated from local curd (Dahi). This isolate has a broad-spectrum inhibitory activity that can inhibit the growth of both food spoilage and pathogenic bacteria. According to results It was clear that protease-sensitive antimicrobial substance produced from strain P26 is more effective as compared to the antibiotic kanamycin. Maximum activity was shown against Staphylococcus species, a pathogen that is a common cause of gastroenteritis worldwide. This substance was active at 100 ºC for 30 minutes and pH (2-9). The activity was lost after treatment with proteases, so it is classified as bacteriocin.Conclusion: Bacteriocin P26 is a more effective antibacterial agent than kanamycin, and it can be produced cheaply using local cardkey.Keywords: Protease; Bacteriocin; Staphylococcus carnosus; Kanamyci

Transformation, evaluation of GTGene and multivariate genetic analysis for morpho-physiological and yield attributing traits in Zea mays

Maize is the 3rd major crop grown all over the world that fulfills the needs of millions of people. Various biotic and abiotic factors caused reduction in grain yield of maize, among them weeds show most adverse effects. Objective of this study was to develop glyphosate resistance maize for developing maize hybrids and synthetic varieties with high grain and fodder yield potential. Glyphosate is a broad spectrum herbicide and resistance of crop against the herbicide, allows post emergence application, which otherwise is impossible. Higher GTG crude protein (479.94μg/g) was recorded for CIL 194-975 plant. The plant CIL 194-1786 showed higher expression level of GTG protein, indicated that transformation efficiency was better for line CIL-194 than CIL-123. GTGene stably integrated to the genome of the maize lines CIL-194 and CIL-123, these transformed lines showed more ability to cope with herbicides as compared with non-transformed lines in greenhouse and field trials. The transgenic lines were sown in field and data was recorded for various morpho-physiological, grain, fodder yield and quality traits. Data was statistically analyzed to check significance of results at <0.05% probability level. It was concluded from heritability, genetic advance, stepwise multiple linear regression, principle component and factor analysis that the selection on the basis of grain yield, green fodder yield, stem diameter, cob weight, stomata conductance, chlorophyll contents, photosynthetic rate, cob length, grain protein, grain oil, embryo percentage and grain starch may be fruitful keeping in view as the major contributing traits to improve crop yield and production. It was suggested that the transgenic lines for glyphosate resistance may be used to develop transgenic hybrids and synthetic varieties with higher grain yield with high quality

Transgenic maize inbred lines expressing high levels of Bacillus thuringiensis vegetative insecticidal protein (Vip3Aa86) offer effective control of maize stem borer (Chilo partellus)

The increasing incidence of field-evolved resistance in Lepidoptera (bollworms) insects towards Bt δ-endotoxins necessitates the need for an alternate strategy to prolong crop resistance. We have investigated the efficacy of Bacillus thuringiensis (Bt) derived toxin, the Vegetative Insecticidal protein Vip3Aa86 to manage maize stem borer in transgenic maize lines. Vip3A proteins do not share any midgut receptors or mechanism of action with any Cry insecticidal proteins and therefore are expected to possess toxicity even in the Bt resistant insects. The transgenic maize inbred lines generated through Agrobacterium-mediated transformation expressing a codon optimized, synthetic vip3Aa86 gene under the influence of the Poly ubiquitin promoter. The T0 progenitor plants were screened initially through GFP reporter gene expression and transgene insertion by specific amplifications that identified four vip3Aa86 transgenic maize lines. Highest vip3Aa86 transcript abundance was observed in the V1 transgenic line while lowest was observed in the VA8 transgenic maize line when subjected to relative mRNA expression analysis. The concentration of Vip3Aa86 protein in T1 transgenic maize lines ranged from 0.94 to 2.24 µg g− 1 leaf fresh weight. The percentage mortality of Chilo partellus was 76.6%, 56.7%, 40% and 53.3% respectively when fed on V1, V10, V12 and VA8 transgenic maize lines of T1 plants, for a period of 72 h in comparison to a control, non-transgenic maize sample. The study concluded that vip3Aa86 insecticidal gene holds great potential against maize stem borer and can be used in gene-pyramiding with Bt crops to prolong the crop resistance

Trackable CEMB-Klean Cotton Transgenic Technology: Afforadable Climate Neutral Agri-biotech Industrialization for Developing Countries

Background: Transgenic technology reflects the incorporation of novel useful traits in crop plants like cotton for economic benefits by overcoming the problems including insects' pests and weeds in special. The present study is the success story of the continuous effort of CEMB team started back in the 1990s. Methods: This study includes characterization of a large number of Bacillus thuringiensis (Bt) strains taken from local soil and subjected to direct transformation of isolated BT genes into local cotton cultivars. Protocols for transformation into cotton plants were optimized and validated by the development of double gene codon optimized (Cry1Ac and Cry2A) transgenic cotton varieties. Results: The resulting GMOs in the form of CEMB-33, CA-12, CEMB-66 have been approved by Punjab Seed Council in 2013 and 2016 respectively. Double Bt and weedicide resistant cotton harboring CEMB-Modified and codon optimized cp4EPSPS (GTGene). These varieties can tolerate glyphosate spray @ 1900ml per acre without the appearance of necrotic spots/shedding and complete removal of all surrounding weeds in the cotton field is a significant advance to boost cotton production without spending much on insecticides and herbicides. Conclusion: In the current report, two unique sets of primers which amplify 1.1 Kb for CEMB-double Bt genes and 660 bp product for CEMB-Modified cp4EPSPS (GTGene) were tested. CEMB cotton variety CKC-01 is specially designed as low cost and easy to use by local farmer's technology has the potential to revolutionize the cotton growing culture of the country.Higher Education Commission (HEC) of PakistanOpen access journalThis item from the UA Faculty Publications collection is made available by the University of Arizona with support from the University of Arizona Libraries. If you have questions, please contact us at [email protected]