Equine degenerative myeloencephalopathy: prevalence, impact, and management.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy is an inherited neurodegenerative disorder affecting many horse breeds. Clinical signs include a symmetric ataxia and an abnormal stance at rest, similar to cervical vertebral compressive myelopathy, equine protozoal myeloencephalitis, and equine herpesvirus 1 myeloencephalopathy. This review will provide an update on the disease prevalence, management, impact, and ongoing research

Disadvantaged Status and Health Matters Networks Among Low-Income African American Women

A significant gap in current network research relates to understanding the factors that shape the health matters (HM) networks of marginalized, socially disadvantaged populations. This is noteworthy, given that these networks represent a critical resource for mitigating the adverse health effects of both acute and chronic strains associated with marginalized status. Further, research has suggested that the networks of such populations—especially low-income African American women—are unique, and may operate in substantively different ways than those of other groups. Using two waves of data from a sample of low-income African American women, this research identifies the demographic, health status, and health behavior measures at time one that correspond to HM network characteristics at time two, six months later. This study offers preliminary insights on the relationship between key sociodemographic and health status characteristics of low-income African American women and their HM networks, including criminal justice involvement. Findings reveal that though poorer health status and criminal justice involvement correspond to smaller health matters networks, they also correspond to more active and supportive networks

Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM

African American Female Offender\u27s Use of Alternative and Traditional Health Services After Re-Entry: Examining the Behavioral Model for Vulnerable Populations

This is the first known study to use the Gelberg-Andersen Behavioral Model for Vulnerable Populations to predict African American women\u27s use of three types of health services (alternative, hospitalization, and ambulatory) in the 18 months after release from prison. In the multivariate models, the most robust predictors of all three types of service utilization were in the vulnerable theoretical domains. Alternative health services were predicted by ethnic community membership, higher religiosity, and HIV/HCV. Hospitalizations were predicted by the lack of barriers to health care and disability. Ambulatory office visits were predicted by more experiences of gendered racism, a greater number of physical health problems, and HIV/HCV. Findings highlight the importance of cultural factors and HIV/HCV in obtaining both alternative and formal health care during community re-entry. Clinicians and policymakers should consider the salient role that the vulnerable domain plays in offender\u27s accessing health services

Examining the Associations of Racism, Sexism, and Stressful Life Events on Psychological Distress among African-American Women

African-American women may be susceptible to stressful events and adverse health outcomes as a result of their distinct social location at the intersection of gender and race. Here, racism and sexism are examined concurrently using survey data from 204 African-American women residing in a southeastern U.S. urban city. Associations among racism, sexism, and stressful events across social roles and contexts (i.e., social network loss, motherhood and childbirth, employment and finances, personal illness and injury, and victimization) are investigated. Then, the relationships among these stressors on psychological distress are compared, and a moderation model is explored. Findings suggest that racism and sexism are a significant source of stress in the lives of African-American women and are correlated with one another and with other stressful events. Implications for future research and clinical considerations are discussed. (APA PsycInfo Database Record (c) 2016 APA, all rights reserved

Lipid peroxidation biomarkers for evaluating oxidative stress in equine neuroaxonal dystrophy.

BackgroundEquine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurodegenerative disorder affecting genetically predisposed foals maintained on an α-tocopherol (α-TOH) deficient diet. Currently no antemortem diagnostic test for eNAD/EDM is available.HypothesisBecause α-TOH deficiency is associated with increased lipid peroxidation, it was hypothesized that F2 -isoprostanes (F2 IsoP), F4 -neuroprostanes (F4 NP) and oxysterols derived from free radical oxidation would be increased in the cerebrospinal fluid (CSF) and neural tissue of eNAD/EDM affected horses and could serve as potential biomarkers for disease.AnimalsIsoprostane Study A: 14 Quarter horse foals (10 healthy foals and 4 eNAD/EDM affected foals) at 1 and 6 months of age. Isoprostane Study B: 17 eNAD/EDM affected and 10 unaffected horses ≥ 1-4 years of age. Oxysterol study: eNAD/EDM affected (n = 14, serum; n = 11, CSF; n = 10, spinal cord [SC]) and unaffected horses 1-4 years of age (n = 12, serum; n = 10, CSF; n = 7, SC).ProceduresCerebrospinal fluid [F2 IsoP] and [F4 NP] were assessed using gas chromatography-negative ion chemical ionization mass spectrometry. Serum, CSF, and cervical SC [oxysterols] were quantified using high performance liquid chromatography mass spectrometry. Results were compared with respective α-TOH concentrations.ResultsSpinal cord [7-ketocholesterol], [7-hydroxycholesterol], and [7-keto-27-hydrocholesterol] were higher in eNAD/EDM horses whereas [24-ketocholesterol] was lower. No significant difference was found in CSF [F2 IsoP] and [F4 NP], serum [oxysterols] and CSF [oxysterols] between eNAD/EDM affected and unaffected horses. No correlation was found between [F2 IsoP], [F4 NP], or [oxysterols] and respective [α-TOH].Conclusions and clinical importanceIn the SC, targeted markers of cholesterol oxidation were significantly increased in horses with eNAD/EDM

Functionally Annotating Regulatory Elements in the Equine Genome Using Histone Mark ChIP-Seq.

One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part of the FAANG equine biobank from two thoroughbred mares. Data were generated according to optimized experimental parameters developed during quality control testing. To ensure that we obtained sufficient ChIP and successful peak-calling, data and peak-calls were assessed using six quality metrics, replicate comparisons, and site-specific evaluations. Tissue specificity was explored by identifying binding motifs within unique active regions, and motifs were further characterized by gene ontology (GO) and protein-protein interaction analyses. The histone marks identified in this study represent some of the first resources for tissue-specific regulation within the equine genome. As such, these publicly available annotation data can be used to advance equine studies investigating health, performance, reproduction, and other traits of economic interest in the horse

High time to enhance dancer welfare:a call to action to improve safeguarding and abuse prevention in dance

While there is a lack of research into abuse in elite dance, numerous allegations of emotional, sexual and physical abuse of dancers can be found anecdotally in the media, legal convictions and personal accounts. As more dancers speak out, the scale of the problem within preprofessional schools and professional companies is becoming apparent. Accordingly, effective safeguarding mechanisms for preventing, identifying and reporting abuse are urgently needed. This viewpoint is intended to raise health professionals' awareness of factors contributing to abusive practices found in dance environments and the potential clinical implications of abuse to dancers' health and well-being. We also call for research and policy engagement on safeguarding and abuse prevention designed and implemented in partnership with stakeholders, aiming to promote safe and positive dance environments for all.</p