Detection of node group membership in networks with group overlap

Most networks found in social and biochemical systems have modular structures. An important question prompted by the modularity of these networks is whether nodes can be said to belong to a single group. If they cannot, we would need to consider the role of "overlapping communities." Despite some efforts in this direction, the problem of detecting overlapping groups remains unsolved because there is neither a formal definition of overlapping community, nor an ensemble of networks with which to test the performance of group detection algorithms when nodes can belong to more than one group. Here, we introduce an ensemble of networks with overlapping groups. We then apply three group identification methods--modularity maximization, k-clique percolation, and modularity-landscape surveying--to these networks. We find that the modularity-landscape surveying method is the only one able to detect heterogeneities in node memberships, and that those heterogeneities are only detectable when the overlap is small. Surprisingly, we find that the k-clique percolation method is unable to detect node membership for the overlapping case.Comment: 12 pages, 6 figures. To appear in Euro. Phys. J

Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Characterization of cell-type specific responses in C. elegans experiencing misfolded protein stress: How do some cells save themselves while others die?

To maintain viability, cells must resolve misfolded protein stress; the inability to do so often triggers cell death, most notably in neurons during neurodegenerative disease. The NAC is a highly conserved translational chaperone essential for protein folding and localization to organelles throughout the cell. In C. elegans, depletion of the NAC initiates misfolded protein stress specifically in the endoplasmic reticulum, inducing a response that upregulates the HSP-4 chaperone in an attempt to prevent cell death. This upregulation is robust but not uniform, and deficient in regions containing neurons. We are characterizing this non-uniform stress response to determine if HSP-4 upregulation is cell-specific and correlates with survival. Additionally, there is evidence that the NAC may function in engaging premature and/or atypical differentiation under stress conditions. We’ve developed a protocol that characterizes the differentiation patterns and stress responses in NAC-depleted C. elegans. Our results indicate that NAC-depleted C. elegans have altered gut cell differentiation patterns when compared to control treatments. Furthermore, control studies were conducted to determine baseline patterns of HSP-4 expression in relation to the location of gut cells. Future studies will investigate differentiation patterns of muscle and neuronal cells in NAC-depleted C. elegans as well as characterizing the upregulation of HSP-4 in gut, muscle, and neuronal cells within NAC-depleted C. elegans

SB 17 - Alcoholic Beverages

Georgia law previously allowed counties and municipalities to permit the sale of alcoholic beverages on Sundays from 12:30 P.M. until 11:30 P.M. This Act, deemed “the Brunch Bill,” authorizes the counties and municipalities that have affirmatively voted by referendum to sell alcoholic beverages on Sundays to sell them earlier, at 11:00 A.M., if approved by a second referendum vote. This change applies to restaurants that make at least 50% of their revenue from the sale of food and hotels, and Georgia wineries

“I Didn’t Know Anything About It”: Critical Pedagogy, Cultural Literacy, and (Missed?) Opportunities for Praxis

This study seeks to theorize and contextualize what happened in an undergraduate senior capstone course focusing on cultural literacy and critical pedagogy. Through our analysis and critical dialogue we came to recognize that while each cultural literacy circle reported positive outcomes, and positive feelings from group members about how they felt participating in the circles, only one group took action in a material way meant to explicitly combat oppression. Nearly every group talked about oppression and the struggle for justice, but ultimately their work remained at the level of discourse. They thought about oppression, talked and read about oppression, but their work as cultural literacy circles, with one exception, did not lead to concerted efforts to make an intervention in the historical reality their group focused on. We conclude with implications of these outcomes for others whose courses center critical pedagogy as both a topic of study as well as a pedagogical approach

Aquifer Depletion and the Cost of Water Conservation: The Southern High Plains of Texas Case

Irrigated agriculture has played a vital role in the development and growth of the Great Plains Region of the United States. The primary source of water for irrigation in this region is the Ogallala Aquifer. The Southern portion of the Ogallala Aquifer is considered exhaustible due to the low level of recharge relative to the quantities of water pumped. Analysis and evaluation of water conservation policies which could extend the economic life of the Ogallala Aquifer in the Southern High Plains of Texas and Eastern New Mexico, and which could contribute to maintaining the viability of the regional economy is important. This study evaluates the impacts of water conservation policies which limit drawdown of the Ogallala Aquifer. County level dynamic optimization models maximizing net present value of net returns to land, management, groundwater, and irrigation systems over a sixty year planning horizon were formulated to evaluate three aquifer drawdown restrictions. The results of this study indicate that because of the differences in hydrologic characteristics and current irrigation levels across counties in the study area, blanket water conservation policies for the region as a whole are likely to be inefficient. This study concludes that for this region, water conservation policies that focus on counties that would deplete the aquifer to less than 30 ft. of saturated thickness possess the lowest implicit cost of conserving saturated thickness.water conservation, water policy evaluation, aquifer management, dynamic optimization, Resource /Energy Economics and Policy,

Policy Alternatives for the Southern Ogallala Aquifer

Due to declining water levels in the Ogallala Aquifer, policy alternatives for extending the life of the aquifer for irrigation and other purposes are evaluated. The study concludes that blanket water conservation policies for the region are likely to be inefficient because of economic and hydrologic differences in the region.Resource /Energy Economics and Policy,

Genetic ancestry of participants in the National Children's Study.

BackgroundThe National Children's Study (NCS) is a prospective epidemiological study in the USA tasked with identifying a nationally representative sample of 100,000 children, and following them from their gestation until they are 21 years of age. The objective of the study is to measure environmental and genetic influences on growth, development, and health. Determination of the ancestry of these NCS participants is important for assessing the diversity of study participants and for examining the effect of ancestry on various health outcomes.ResultsWe estimated the genetic ancestry of a convenience sample of 641 parents enrolled at the 7 original NCS Vanguard sites, by analyzing 30,000 markers on exome arrays, using the 1000 Genomes Project superpopulations as reference populations, and compared this with the measures of self-reported ethnicity and race. For 99% of the individuals, self-reported ethnicity and race agreed with the predicted superpopulation. NCS individuals self-reporting as Asian had genetic ancestry of either South Asian or East Asian groups, while those reporting as either Hispanic White or Hispanic Other had similar genetic ancestry. Of the 33 individuals who self-reported as Multiracial or Non-Hispanic Other, 33% matched the South Asian or East Asian groups, while these groups represented only 4.4% of the other reported categories.ConclusionsOur data suggest that self-reported ethnicity and race have some limitations in accurately capturing Hispanic and South Asian populations. Overall, however, our data indicate that despite the complexity of the US population, individuals know their ancestral origins, and that self-reported ethnicity and race is a reliable indicator of genetic ancestry