3,886 research outputs found
Recommended from our members
Equine degenerative myeloencephalopathy: prevalence, impact, and management.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy is an inherited neurodegenerative disorder affecting many horse breeds. Clinical signs include a symmetric ataxia and an abnormal stance at rest, similar to cervical vertebral compressive myelopathy, equine protozoal myeloencephalitis, and equine herpesvirus 1 myeloencephalopathy. This review will provide an update on the disease prevalence, management, impact, and ongoing research
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Recommended from our members
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses
Genetic ancestry of participants in the National Children's Study.
BackgroundThe National Children's Study (NCS) is a prospective epidemiological study in the USA tasked with identifying a nationally representative sample of 100,000 children, and following them from their gestation until they are 21 years of age. The objective of the study is to measure environmental and genetic influences on growth, development, and health. Determination of the ancestry of these NCS participants is important for assessing the diversity of study participants and for examining the effect of ancestry on various health outcomes.ResultsWe estimated the genetic ancestry of a convenience sample of 641 parents enrolled at the 7 original NCS Vanguard sites, by analyzing 30,000 markers on exome arrays, using the 1000 Genomes Project superpopulations as reference populations, and compared this with the measures of self-reported ethnicity and race. For 99% of the individuals, self-reported ethnicity and race agreed with the predicted superpopulation. NCS individuals self-reporting as Asian had genetic ancestry of either South Asian or East Asian groups, while those reporting as either Hispanic White or Hispanic Other had similar genetic ancestry. Of the 33 individuals who self-reported as Multiracial or Non-Hispanic Other, 33% matched the South Asian or East Asian groups, while these groups represented only 4.4% of the other reported categories.ConclusionsOur data suggest that self-reported ethnicity and race have some limitations in accurately capturing Hispanic and South Asian populations. Overall, however, our data indicate that despite the complexity of the US population, individuals know their ancestral origins, and that self-reported ethnicity and race is a reliable indicator of genetic ancestry
Recommended from our members
Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM
Consanguinity and rare mutations outside of MCCC genes underlie nonspecific phenotypes of MCCD.
Purpose3-Methylcrotonyl-CoA carboxylase deficiency (MCCD) is an autosomal recessive disorder of leucine catabolism that has a highly variable clinical phenotype, ranging from acute metabolic acidosis to nonspecific symptoms such as developmental delay, failure to thrive, hemiparesis, muscular hypotonia, and multiple sclerosis. Implementation of newborn screening for MCCD has resulted in broadening the range of phenotypic expression to include asymptomatic adults. The purpose of this study was to identify factors underlying the varying phenotypes of MCCD.MethodsWe performed exome sequencing on DNA from 33 cases and 108 healthy controls. We examined these data for associations between either MCC mutational status, genetic ancestry, or consanguinity and the absence or presence/specificity of clinical symptoms in MCCD cases.ResultsWe determined that individuals with nonspecific clinical phenotypes are highly inbred compared with cases that are asymptomatic and healthy controls. For 5 of these 10 individuals, we discovered a homozygous damaging mutation in a disease gene that is likely to underlie their nonspecific clinical phenotypes previously attributed to MCCD.ConclusionOur study shows that nonspecific phenotypes attributed to MCCD are associated with consanguinity and are likely not due to mutations in the MCC enzyme but result from rare homozygous mutations in other disease genes.Genet Med 17 8, 660-667
Recommended from our members
Functionally Annotating Regulatory Elements in the Equine Genome Using Histone Mark ChIP-Seq.
One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part of the FAANG equine biobank from two thoroughbred mares. Data were generated according to optimized experimental parameters developed during quality control testing. To ensure that we obtained sufficient ChIP and successful peak-calling, data and peak-calls were assessed using six quality metrics, replicate comparisons, and site-specific evaluations. Tissue specificity was explored by identifying binding motifs within unique active regions, and motifs were further characterized by gene ontology (GO) and protein-protein interaction analyses. The histone marks identified in this study represent some of the first resources for tissue-specific regulation within the equine genome. As such, these publicly available annotation data can be used to advance equine studies investigating health, performance, reproduction, and other traits of economic interest in the horse
Misplaced Trust: Measuring the Interference of Machine Learning in Human Decision-Making
ML decision-aid systems are increasingly common on the web, but their
successful integration relies on people trusting them appropriately: they
should use the system to fill in gaps in their ability, but recognize signals
that the system might be incorrect. We measured how people's trust in ML
recommendations differs by expertise and with more system information through a
task-based study of 175 adults. We used two tasks that are difficult for
humans: comparing large crowd sizes and identifying similar-looking animals.
Our results provide three key insights: (1) People trust incorrect ML
recommendations for tasks that they perform correctly the majority of the time,
even if they have high prior knowledge about ML or are given information
indicating the system is not confident in its prediction; (2) Four different
types of system information all increased people's trust in recommendations;
and (3) Math and logic skills may be as important as ML for decision-makers
working with ML recommendations.Comment: 10 page
- …