Klotho Protects Dopaminergic Neuron Oxidant-Induced Degeneration by Modulating ASK1 and p38 MAPK Signaling Pathways

<div><p>Klotho transgenic mice exhibit resistance to oxidative stress as measured by their urinal levels of 8-hydroxy-2-deoxyguanosine, albeit this anti-oxidant defense mechanism has not been locally investigated in the brain. Here, we tested the hypothesis that the reactive oxygen species (ROS)-sensitive apoptosis signal-regulating kinase 1 (ASK1)/p38 MAPK pathway regulates stress levels in the brain of these mice and showed that: 1) the ratio of free ASK1 to thioredoxin (Trx)-bound ASK1 is relatively lower in the transgenic brain whereas the reverse is true for the Klotho knockout mice; 2) the reduced p38 activation level in the transgene corresponds to higher level of ASK1-bound Trx, while the KO mice showed elevated p38 activation and lower level of–bound Trx; and 3) that 14-3-3ζ is hyper phosphorylated (Ser-58) in the transgene which correlated with increased monomer forms. In addition, we evaluated the <i>in vivo</i> robustness of the protection by challenging the brains of Klotho transgenic mice with a neurotoxin, MPTP and analyzed for residual neuron numbers and integrity in the substantia nigra pars compacta. Our results show that Klotho overexpression significantly protects dopaminergic neurons against oxidative damage, partly by modulating p38 MAPK activation level. Our data highlight the importance of ASK1/p38 MAPK pathway in the brain and identify Klotho as a possible anti-oxidant effector.</p></div

Summary of seven protein spots of interest identified by mass spectrometry on 2D gels of Klotho mutant and wild type mice.

<p>^<i>a</i>Spots 1–3 were identified based on their differential phosphorylation [KO mice (klkl) vs. wild type control) <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.g002" target="_blank">Fig 2</a>; spots 4 and 5 were downregulated in klkl vs. wild type; spots 6 and 7 were upregulated in klkl mice.</p><p>*expt., experimentally obtained p<i>I</i>s and M<i>r</i>s are those analyzed from 2D gels; deter., determined pIs and Mrs values are based on primary sequence data and were obtained from literature. DHLA, dihydrolipoamide</p><p>Summary of seven protein spots of interest identified by mass spectrometry on 2D gels of Klotho mutant and wild type mice.</p

Close-up view of images of 2D-GE extracted from Fig 2.

<p>(A) Plots of phosphorylation levels of ProQ diamond stained 14-3-3 proteins. The Pro-Q diamond stained gel images in Fig 3B (a-d) are close-up views of areas of spots in WT1, <i>kl/kl</i>, WT2 and EFmKL48 full gels respectively within pI 4.3–4.8. Plots are pooled data from two replicate gels and deviations are shown. Representative ProQ diamond gel images and their corresponding positions in SyproRuby-stained protein gels are shown together to normalize for levels of protein load. Digitized values of stained spots used for the plots are shown in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.s003" target="_blank">S3 Table</a>.</p

Levels of p38 MAPK activation and Trx/ASK1 complex formation in Klotho KO and Klotho transgenic mice.

<p>(A) Plots of phosphorylation levels of p38 MAPK in <i>kl/kl</i> mice and their WT littermates (WT1). Each bar represents average of three individual mouse and deviations are shown. *p< 0.05 between <i>kl/kl</i> and WT1 mice. (B) Levels of Trx bound to ASK1 in <i>kl/kl</i> and WT1 mice. ASK1 was IP with rabbit polyclonal ASK1 antibody; co-precipitated Trx was revealed by Western blot. Pooled total proteins from three mice were used for the IP. (C) Levels of p38 MAPK activation in EFmKL48 mice and their WT control (WT2). Each plot represents average of three mice and deviations are shown. *p< 0.05 between EFmKL48 and WT2 mice. (D) Levels of Trx bound to ASK1 in EFmKL48 mice and their WT2 control. *p< 0.05 between EFmKL48 mice and control WT2. Representative Western blot of the samples are shown below each plot. Digitized values of the WB signals were obtained with UN-SCAN-IT^TM software (Silk Scientific, Utah) and values are shown in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.s001" target="_blank">S1</a> and <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.s002" target="_blank">S2</a> Tables. Phosphorylation levels were normalized by stripping same membrane and re-probing with the corresponding total antibody.</p

The analyses of Klotho expression from various regions in the brain.

<p>(A) RT-PCR profile of Klotho expression relative to GAPDH control. The approximately 630 base pair Klotho product was amplified from normal mouse brain sections using the following specific primers: TGATCAGCGAGCTGGTGCAC (forward), and CCTGTACCTCCAAGTAATCG (reverse). (B) qRT-PCR profile of Klotho expressiondeviations ± SE are shown. (C-D) Immunohistochemical localization of Klotho expression in the SN regions. Details are described in Materials and Methods. Data used for plots in the PCR analyses are shown in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.s008" target="_blank">S8 Table</a>.</p

Images of 2D-GE analysis of brain lysates of Klotho KO and Klotho transgenic mice and their WT littermates.

<p>(A-H) Representative protein gels stained for phosphorylation (ProQ diamond) and total protein (SyproRuby) for WT (WTI or WT2), Klotho KO (<i>klkl</i>), and Klotho transgenic (<i>EFmKL48</i>) mice. Circled spots are proteins determined to be either differentially expressed (spots # 4–7) or phosphorylated (spots # 1–3) between WT1 and <i>klkl</i> or <i>EFmKL48</i> and <i>klkl</i>. These are summarized in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.t001" target="_blank">Table 1</a>.</p

Basal levels of 14-3-3ζ monomer in Klotho KO and Klotho transgenic mice.

<p>(A) Plot of native PAGE Western blot of WT1 and <i>kl/kl</i> mice probed with 14-3-3ζ antibody. The 14-3-3ζ antibody recognizes a predominant ~30 <i>k</i>Da protein band representing the expected size of a monomer. *p< 0.05, between WT1 and <i>kl/kl</i>. (B) Replicate samples were separated under SDS-PAGE, electroblotted onto PVDF membrane and probed with same antibody to account for lysate levels of total 14-3-3ζ. (C) Native PAGE Western blot of WT2 verses EFmKL48 performed under identical conditions described for (A). *p< 0.05, between WT2 and EFmKL48. (D) Replicate samples were separated under SDS-PAGE, electroblotted onto PVDF membrane and probed with same antibody to account for lysate levels of total 14-3-3ζ. Digitized values of the WB signals used in the plots are shown in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.s005" target="_blank">S5</a> and <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.s006" target="_blank">S6</a> Tables.</p

Analysis of dopamine (DA) neurons in substantia nigra (SN) following MPTP treatment of Klotho transgenic (EFmKL48) mice.

<p>(A) SN dopamine neurons stained for tyrosine hydroxylase (TH). The SN pars compacta (SNc) neurons which are target for neurodegeneration are shown in MPTP-treated (I and II) and saline control (III and IV) mice. The SNc neurons show no evidence of neurodegeneration following a cumulative dose of 40 mg/kg MPTP. (B-C) Analysis of p38 MAPK activation levels induced by MPTP in the SN. (B) Nitrocellulose backed glass slides arrayed with lysates prepared from SN regions in the brain of various Klotho mouse models and probed with phospho-p38 MAPK antibody and quantum dot (Qdot) secondary antibody detection system (655 nm). Replicate slide was stained for protein with SyproRuby flourescent reagent (Life Technologies). Slides were imaged using the ScanArray^TM System (Perkin Elmer). The signal intensity is pseudo-colored, with the lowest intensities in the blue spectrum and the highest intensities in the red-saturated signals appear white. (C) Normalized plots of the phospho-p38 MAPK level. The error bar denotes triplicate array of sample numbered 1–3 and deviations are shown ± SEM. Digitized values of stained spots are shown in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0139914#pone.0139914.s007" target="_blank">S7 Table</a>.</p