Antimicrobial Resistance and Whole Genome Sequencing

The fast spread of antimicrobial resistance (AMR) and lack of alternative antibiotics have been declared as a global public health emergency. The greatest impact of AMR could be seen in countries where the prevalence of multidrug-resistant pathogens is growing. Whole-genome sequencing (WGS) as a new tool has been shown as a very potential approach that is applicable for many kinds of genomic investigations. In term of AMR, using whole-genome sequencing (WGS) for molecular surveillance can be a valuable addition to phenotypic surveillance of AMR. This approach provides insights into the genetic basis of resistance mechanisms, pathogen evolution and population dynamics. So, its introduction in everyday practice could be extremely valuable tool for molecular surveillance of AMR

Interleukin 10- 592 C/A variant association with a HPV E6/E7 mRNA expesion in group of Macedonian women

Statement of the Problem: Interleukin 10 (IL-10) is an immunosuppressive cytokine, and its genetic variant could have an indirect impact on viral biology and HPV E6/E7 mRNA expression as well. In the study, we evaluate the association between IL10 -592 C/A polymorphism and HPV E6/E7 mRNA expression in a group of women from R North Macedonia. Using PreTect HPV proofer (Norchip) and HPV 4 ACE (Seegen) tests we analyzed 272 women’s cervical samples for HPV E6/E7 mRNA and HPV DNA presence respectively. The cases were stratified into three groups: double-positive (n=108, positive for both tests), negative (n=51, negative for HPV E6/E7 mRNA and HPV DNA positive), and the control group (n=113, negative for both tests). The IL10-592 C/A polymorphism was analyzed using polymerase chain reaction-restriction fragment length polymorphism.. Findings: The results showed the CC genotype and the C allele frequencies of IL10-592C/A were significantly higher in double-positive (59.3% and 78.2%) compared to negative group (39.2% and 65.7%), (p=0.01, CI=0.44;0.22-0.87- dominant model; and p=0.01, CI =0.53; 0.3-0.8 respectively). Conclusion & Significance: The CC genotype and C allele of IL10-592 showed to be associated with HPV E6/E7 mRNA but not with HPV DNA positivity, which could mean this polymorphism could affect the course of the infection only after HPV onset and it is not associated with susceptibility to HPV. Image Recent Publications (minimum 5) 1. Lowe PR, Galley HF, Abdel-Fattah A, Webster NR. Influence of interleukin-10 polymorphisms on interleukin-10 expression and survival in critically ill patients. Critical care medicine. Jan 2003;31(1):34-8. doi:10.1097/00003246-200301000-00005 2. Langsenlehner U, Krippl P, Renner W, et al. Interleukin-10 promoter polymorphism is associated with decreased breast cancer risk. Breast cancer research and treatment. Mar 2005;90(2):113-5. doi:10.1007/s10549-004-3607-7 3. Berti FCB, Pereira APL, Cebinelli GCM, Trugilo KP, Brajão de Oliveira K. The role of interleukin 10 in human papilloma virus infection and progression to cervical carcinoma. Cytokine Growth Factor Rev. Apr 2017;34:1-13. doi:10.1016/j.cytogfr.2017.03.002 4. Brooks DG, Trifilo MJ, Edelmann KH, Teyton L, McGavern DB, Oldstone MB. Interleukin-10 determines viral clearance or persistence in vivo. Nat Med. Nov 2006;12(11):1301-9. doi:10.1038/nm1492 5. Arany I, Grattendick KG, Tyring SK. Interleukin-10 induces transcription of the early promoter of human papillomavirus type 16 (HPV16) through the 5'-segment of the upstream regulatory region (URR). Antiviral Res. Aug 2002;55(2):331-9. doi:10.1016/s0166-3542(02)00070-

Association of HPV E6/E7 mRNA expression with IL-10 c. -592C>A single nucleotide polymorphism

Background/Objectives: High-risk HPV persistent infections with HPV E6/E7 mRNA expression are a highly predictive marker for the progression of cervical intraepithelial lesion toward cervical cancer (CCa). Still, only a low percentage of HPV-positive women, the infection remains persistent with continuous HPV E6/E7 mRNA expression. The individual host's immune response is an important factor influencing viral biological activity and HPV E6/E7 mRNA expression. Immunomodulatory effects of cytokines such as IL-10 and its genetic variants may confer variation in host response toward HPV clearance as well as the influence of the expression of these viral oncogenes. Methods: This study evaluates the association of IL-10 c. -592C>A single nucleotide polymorphism (SNP) with HPV E6/E7 mRNA positivity. We conducted a case-control study that included 159 HPV DNA-positive women and 113 HPV DNA-negative women with no prior history of HPV positivity or cervical abnormality, as a control group. Women from both groups were genotyped for IL-10 c. -592C> A using RFLP analysis. Additionally, the cases group was tested for HPV E6/E7 mRNA expression using commercial tests. The statistical significance of the association was assessed by the chi-square test and the OD ratio. Results: The results showed the CC genotype (59.3%) was significantly more common in women positive for both tests compared to those positive only for HPV DNA (39.2%) [p = 0.018; OR = 2.25 (95% CI: 1.14-4.45)], and compared to control and HPV DNA positive groups together [p = 0.04; OR: 1.68 (95% CI: 1.03-2.75)], but not compared to the control group alone (49.6%). The frequency of the C allele in the HPV E6/E7 mRNA positive group (78.2%) was significantly more frequent [p = 0.016, OR= 1.88 (95% CI: 1.11-3.16)] than only HPV DNA positive (65.7%) and with borderline significance compared to both HPV E6/E7 mRNA negative groups [p = 0.04, OR=1.88 (95% CI: 1.11-3.16)]. Conclusions: In conclusion, the C/CC variant of IL-10 c. -592C>A SNP may influence a more frequent rate of HPV E6/E7 mRNA expression after the onset of HPV infection. This genotype is not associated with susceptibility to this infection given the absence of association with HPV DNA alone. These results should be confirmed in a larger epidemiological study involving a much larger number of wome

HPV E6/E7mRNA association with interleukin 10 (rs1800872) polymorphism in a group of Macedonian women

Interleukin 10 (IL-10) is an immunosuppressive cytokine and its genetic variants could have an indirect impact on viral biology and human papillomavirus (HPV) E6/E7 messenger RNA (mRNA) expression as well. This study evaluates the association between IL-10-592 C/A (rs1800872) single-nucleotide polymorphism and HPV E6/E7 mRNA expression in a group of women from the Republic of North Macedonia. Using a commercial test, 272 women's cervical samples were analyzed for HPV E6/E7 mRNA and HPV DNA presence. The cases were stratified into three groups: double-positive (n = 108, positive for both tests), negative (n = 51, negative for HPV E6/E7 mRNA and HPV DNA positive), and the control group (n = 113, negative for both tests). The IL-10-592 C/A polymorphism was analyzed using polymerase chain reaction-restriction fragment length polymorphism. The results showed the CC genotype and the C allele frequencies of IL-10-592C/A were significantly higher in double-positive (59.3% and 78.2%) compared to negative group (39.2% and 65.7%), (p = 0.018, confidence interval [CI] = 2.25; 1.14-4.45 and p = 0.016, CI = 1.88; 1.11-3.16, respectively). The CC genotype and C allele of rs1800872 polymorphism were shown to be associated with HPV E6/E7 mRNA but not with HPV DNA positivity, which implies a possible role of this polymorphism in the course of the infection only after HPV onset, and lack of association with the susceptibility to HPV

HPV E6/E7mRNA association with Interleukin - 10 592C/A variant in group of Macedonian women

Interleukin 10 (IL-10) is an immunosuppressive cytokine, and its genetic variant could have an indirect impact on viral biology and HPV E6/E7 mRNA expression as well. In the study, we evaluate the association between IL10 -592 C/A polymorphism and HPV E6/E7 mRNA expression in a group of women from R North Macedonia. Methods: Using commercial tests, we analyzed 272 women’s cervical samples for HPV E6/E7 mRNA and HPV DNA presence respectively. The cases were stratified into three groups: double-positive (n=108, positive for both tests), negative (n=51, negative for HPV E6/E7 mRNA and HPV DNA positive), and the control group (n=113, negative for both tests). The IL10-592 C/A polymorphism was analyzed using polymerase chain reaction-restriction fragment length polymorphism.IL-10-592 Genotyping The IL-10-592 polymorphism was analyzed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), using designed. a primer for the promoter region of this gene using primer design software - Primer3Plus http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3pluscgi) sense: GGGGTCATGGTGAGCACTAC and antisense: AAAGTTGGGGACACACAAGC the PCR product was digested with the RsaI restriction enzyme according to the manufacturer’s instruction: 2h on 37°C. The pattern after digestion was analyzed on 2.5 agarose gel. HPV DNA and HPV E6/E7 mRNA detection HPV DNA and E6/E7 mRNA detecting and typing were performed using Seeplex® HPV4A ACE screening, assay Seegene, (Korea), and PreTect HPV Proofer (PreTect AS, Norway) tests respectively. Results: The CC genotype and the C allele frequencies of IL10-592C/A were significantly. higher in double-positive (59.3% and 78.2%) compared to negative group (39.2% and 65.7%), (p=0.01, CI=0.44;0.22-0.87- dominant model; and p=0.01, CI=0.53. 0.3-0.8) respectively and compared to negative and control groups together. Conclusions: The CC genotype and C allele of IL10-592 showed to be associated with HPV E6/E7 mRNA but not with HPV DNA positivity, which could mean this polymorphism could affect the course of the infection only after HPV onset and it is not associated with susceptibility to HPV

Impact of TP53 (rs1042522) and MDM2 (rs2279744) polymorphisms on cervical intraepithelial lesions and cervical cancer in North Macedonian women

Persistent human papillomavirus (HPV) infection is a major factor in the onset of cervical intraepithelial lesion (CIN), but additional factors are needed for their further progression to carcinoma (CCa). Genetic variant in host cell cycle regulation genes such are single nucleotide polymorphisms (SNPs) rs1042522 within the codon 72 of TP53 and rs2279744 within MDM2 promoter genes are plausible factors that could influence cervical carcinogenesis conferring increased attenuation of p53 pathway. The p53 tumour suppressor is gate keeper of cell cycle that regulates cellular pathways such as DNA repair, apoptosis, angiogenesis and is important defence mechanism against cancer onset and progression. The C to G base substitution in codon 72 replacing amino acid Proline with Arginine is considered to produce a more vulnerable variant of p53. high risk HPV E6 oncoprotein binds to p53 and this interaction with rs1042522 variant is even stronger that additionally abrogates p53 function leading to its degradation through ubiquitin dependent pathway. MDM2 oncoprotein is negative regulator of p53 tumour suppression. The variant rs2279744 in its promoter’s region could influence cervical carcinogenesis increasing its affinity of the Sp1 transcription factor. Objective: We investigated the association of these SNPs with the CIN and CCa among women from the Republic of North Macedonia. Using a multiplex PCR SNaPShot analysis, we genotyped rs1042522 and rs2279744 in 131 women with CIN or CCa and 110 cytologically and Human papillomavirus negative women. The allele and genotype frequencies of the variants were analysed using х2 –test in SISA statistic software. The TP53 rs1042522 and MDM2 rs2279744 polymorphic variants showed no association with initiation and development of CIN and CCa. No significant difference in either genotype or allelic frequencies for rs1042522 and rs2279744 between cases and control was found. Stratification of cases group based on grade of the lesion, revelled lower frequency of CC genotype and C allele of rs1042522 in CIN2+ and CCa compared to CIN1 [GG vs CC; p=0.001, OR=0.4; CG vs CC; p=0.04, OR=0.03 and CG+ GG vs CC; p=0.004, OR=0.2]. Furthermore, GG genotype and G allele of rs2279744 showed significantly lower frequency in CIN2+ and CCa cases then in CIN1 [G vs T p=0.02, OR=0.52; GG vs TT; p=0.04, OR=0.29; ТТ vs ТG+GG; p=0.007, OR=0.34]. CONCLUSION The Arg variant of rs1042522 and T allele/TT genotype of rs2279744 are associated with progression of CIN1 to CIN2+ or CCa and may be used as prediction markers in CCa management. Still, clinical importance of these variants warrants further validation in large and more comprehensive studies

Association of p53Pro72Arg (rs1042522) and MDM2309 (rs2279744) polymorphisms with risk for cervical intraepithelial lesions and cervical cancer development in Macedonian women

High risk Human Papillomavirus (HPV) is an important etiological factor in initiation of squamous intraepithelial lesions (SIL), but not enough for malignant progression to cervical cancer (CCa). Single nucleotide polymorphisms (SNPs): rs1042522 within the codon 72 of p53 and rs2279744 within MDM2 promoter gene are plausible factors for development of SIL or CCa conferring increased attenuation of p53 pathway. We investigated the association of these SNPs with the HPV positive SIL and CCa among women from the Republic of Macedonia. Using a multiplex PCR SNaPShot analysis we genotyped rs1042522 and rs2279744 in 131 HPV positive women with SIL or CCa and 110 HPV and cytologicaly negative controls subject. No significant difference in either genotype or allelic frequencies for rs1042522 and rs2279744 between cases and control was found. The stratification of patients on the basis of the lesion grade revealed lower frequency of CC genotype and C allele of rs1042522 in HSIL and CCa compared to LSIL [GG vs CC; p=0.001, OR=0.4; CG vs CC; p=0.04, OR=0.03 and CG+ GG vs CC; p=0.004, OR=0.2]. Additionally TT genotype and T allele of MDM2 309 showed significantly lower frequency in HSIL and CCa group then in LSIL [G vs T p=0.02, OR=0.52; GG vs TT; p=0.04, OR=0.29; ТТ vs ТG+GG; p=0.007, OR=0.34].The Arg variant of rs1042522 and T allele/TT genotype of rs2279744 are associated with progression to LSIL to HSIL or CCa and may be used as prediction markers in CCa management, but the clinical relevant warrants further validation in large and well-designed studies. Keywords: Squamous intraepithelial lesions (SIL), cervical cancer (CCa), Human Papillomavirus (HPV), single nucleotide polymorphism (SNP), cancer and SIL susceptibilit

Humani papilomavirus kao potencijalni čimbenik rizika za oralne premaligne lezije

Oral premalignant lesions (OPLs) and numerous alterations of oral mucosa remain unsolved due to their complex etiopathogenesis. Human papillomaviruses (HPVs), in particular, have been reported as the possible risk factors or cofactors. The aim of the study was to determine the association of different HPV types with oral premalignant lesions, and the potential role of smoking and alcohol use. Eighty patients (mean age ± SD, 52.45±5.56) of both genders, 19 (23.75%) male and 61 (76.25%) female, were enrolled in the study. Study group included 40 patients diagnosed with OPLs (leukoplakia, erythroplakia, actinic keratosis and lichen planus), while control group included another 40 patients with healthy oral mucosa. Genotyping of the HPV types was performed by qualitative real-time HPV typing polymerase chain reaction test. HPV DNA was detected in 30% (12/40) of study group patients and 2.5% (1/40) of control group patients. The results revealed the presence of HPV16 in 15% (6/40), HPV56 in 10% (4/40), and HPV18 in 5% (2/40) of study group cases, and HPV31 in 1 (2.5%) control group patient. Th e association of oral HPV positivity and smoking/alcohol use in the study group was not statistically signifi cant (p>0.05). In conclusion, high-risk HPV types are associated with oral premalignant disorders. However, it remains unknown whether HPV acts as an innocent bystander or it has a role in initiating development of premalignant lesions. Smoking and alcohol use were not associated with the existing oral HPV infection.Oralne premaligne lezije (OPL) kao i brojne promjene oralne sluznice ostaju neriješene zbog njihove složene etiopatogeneze. Humani papilomavirusi (HPV) osobito su naglašeni kao mogući čimbenici i su-čimbenici rizika. Cilj ove studije bio je utvrditi udruženost različitih tipova HPV s OPL kao i potencijalnu ulogu pušenja i alkohola. U studiju je bilo uključeno 80 pacijenata (srednja dob ± SD, 52,45±5,56 godina) obaju spolova: 19 (23,75%) muškaraca i 61 (76,25%) žena. Skupinu ispitanika s OPL činilo je 40 pacijenata s dijagnosticiranom OPL (leukoplakija, eritroplakija, aktinična keratoza i lihen planus), dok je kontrolnu skupinu činilo 40 pacijenata sa zdravom oralnom sluznicom. Genotipizacija tipova HPV provedena je kvalitativnim real-time PCR testom. HPV DNK je otkrivena u 30% (12/40) uzoraka ispitivane skupine pacijenata i 2,5% (1/40) uzoraka kontrolne skupine. Rezultati su pokazali prisutnost HPV16 kod 15% (6/40), HPV56 kod 10% (4/40) i HPV18 kod 5% (2/40) uzoraka skupine s OPL, a HPV31 u jednom (2,5%) uzorku kontrolne skupine. Udruženost pozitivnih nalaza za oralni HPV i navika pušenja/alkohola u ispitivanoj skupini nije bila statistički značajna. U zaključku, visoko rizični tipovi HPV udruženi su s OPL, međutim, ostaje nepoznato djeluje li HPV kao nevini suputnik ili možda ima ulogu u razvoju tih lezija. Pušenje i alkohol nisu povezani s postojećom oralnom HPV infekcijom

Human Papillomavirus as a Potential Risk Factor for Oral Premalignant Lesions

Oral premalignant lesions (OPLs) and numerous alterations of oral mucosa remain unsolved due to their complex etiopathogenesis. Human papillomaviruses (HPVs), in particular, have been reported as the possible risk factors or cofactors. The aim of the study was to determine the association of different HPV types with oral premalignant lesions, and the potential role of smoking and alcohol use. Eighty patients (mean age ± SD, 52.45±5.56) of both genders, 19 (23.75%) male and 61 (76.25%) female, were enrolled in the study. Study group included 40 patients diagnosed with OPLs (leukoplakia, erythroplakia, actinic keratosis and lichen planus), while control group included another 40 patients with healthy oral mucosa. Genotyping of the HPV types was performed by qualitative real-time HPV typing polymerase chain reaction test. HPV DNA was detected in 30% (12/40) of study group patients and 2.5% (1/40) of control group patients. The results revealed the presence of HPV16 in 15% (6/40), HPV56 in 10% (4/40), and HPV18 in 5% (2/40) of study group cases, and HPV31 in 1 (2.5%) control group patient. Th e association of oral HPV positivity and smoking/alcohol use in the study group was not statistically significant (p<0.05). In conclusion, high-risk HPV types are associated with oral premalignant disorders. However, it remains unknown whether HPV acts as an innocent bystander or it has a role in initiating development of premalignant lesions. Smoking and alcohol use were not associated with the existing oral HPV infection