Evaluating the accessibility to disabled people of e-assessment tools

E-assessment tools offer enormous potential for educational organisations to support disabled students in a flexible, accessible way, while also helping to meet legal obligations to avoid undue discrimination. However, tools need to support authors in creating assessments without introducing accessibility barriers. Information on the extent to which e-assessment tools support accessible assessment authoring is scarce; and where information does exist, this tends to be focused on the accessibility of the output, rather than the quality of the authoring process. An accessibility evaluation methodology was developed and used by the authors to review a popular e-assessment tool. The review identified a number of accessibility issues with the software interface and output. It also found issues that might limit the ability of authors to create optimally accessible assessments, meaning a modified approach to training and support is required, as well as improvements to the assessment tool. Organisations evaluating e-assessment tools for accessibility therefore need to seriously consider how effective these tools are in supporting accessible authoring, rather than limiting attention to the accessibility of the output of the tool

Staff education – learning about online assessment, online

Over the last eighteen months, the University of Dundee has developed a stable and resilient central Computer Aided Assessment (CAA) system to support student and staff use of online assessment. We recognise six key components to this system: quality software, quality hardware, clear policy and procedures, adequate central staffing support, integration with other online learning systems, and staff education. This paper will focus on our central approach to staff education. The online assessment system was designed and constructed with the guidance and cooperation of many staff members, most of whom had previous experience with computer-based assessments. With the physical systems in place, we initially deployed a conventional staff development programme predominantly based on face-to-face sessions. Feedback from these sessions encouraged us to revise our approach, in order to reflect the complexity of the subject area, and the diverse needs of the target audience. Consequently, we have now largely replaced these sessions with a more comprehensive and interactive course, delivered online using our Blackboard Virtual Learning Environment (VLE) and Questionmark Perception (QMP). The course, Assessment Online, has run on four occasions, equipping over 60 staff members with the tools and skills necessary to design and deliver valid and reliable online assessments. Along this path the course instructors have learned a number of valuable lessons which have, in themselves, resulted in many enhancements to the way the course is delivered. Significantly, as a result of its early success, the 5 week course has now been formally accredited by the University’s Faculty of Education and Social Work and will run biannually

The rapid development of bespoke small unmanned aircraft: a proposed design loop

The ability to quickly fabricate small unmanned aircraft (sUAS) through additive manufacturing (AM) methods opens a range of new possibilities for the design and optimization of these vehicles. In this paper we propose a design loop that makes use of surrogate modelling and AM to reduce the design and optimization time of scientific sUAS. AM reduces the time and effort required to fabricate a complete aircraft, allowing for rapid design iterations and flight testing. Co-Kriging surrogate models allow data collected from test flights to correct Kriging models trained with numerically simulated data. The resulting model provides physically accurate and computationally cheap aircraft performance predictions. A global optimizer is used to search this model to find an optimal design for a bespoke aircraft. This paper presents the design loop and a case study which demonstrates its application

Methods for Multiplex Template Sampling in Digital PCR Assays

<div><p>The efficient use of digital PCR (dPCR) for precision copy number analysis requires high concentrations of target molecules that may be difficult or impossible to obtain from clinical samples. To solve this problem we present a strategy, called Multiplex Template Sampling (MTS), that effectively increases template concentrations by detecting multiple regions of fragmented target molecules. Three alternative assay approaches are presented for implementing MTS analysis of chromosome 21, providing a 10-fold concentration enhancement while preserving assay precision.</p></div

Assessment of chromosome ratio using “short” and “long” multiplexing strategies.

<p>(<b>A</b>) Mean ratio (n = 5) between chromosomes 21 and 6 in normal human adult male DNA as measured by dPCR using ten different primer pairs each specific to one locus on chromosome 21. (<b>B</b>) Mean ratio (n = 5) between chromosome 21 and chromosome 6 as measured by dPCR using multiplexed reactions with one to ten primer pairs in the PCR mix. Reaction volumes are 2 nL, multiplexing level (horizontal axis) increases from 1× to 10×. Two approaches compared: with short primers and long primers plus a pair of universal primers. Upper and lower boundaries of 95% confidence intervals <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0098341#pone.0098341-Dube1" target="_blank">[22]</a> are shown with dashed lines.</p

dPCR quality comparison between “short” and “long” multiplexing strategies.

<p>(<b>A</b>) Boxplots for comparison of Ct values (vertical axis) distribution in 2 nL PCR compartments filled with variable multiplexing level (horizontal axis) primer mixes. Upper panel – PCR mixes supplemented with short primers. Lower panel – PCR mixes supplemented with combination of long and plus a pair of universal primers. Red crosses denote outliers that are larger than the 75^th percentile plus 1.5× the interquartile range or smaller than the 25^th percentile minus 1.5× the interquartile range. This corresponds to approximately ±2.7σ and 99.3% coverage assuming that the data are normally distributed. (<b>B</b>) The ratio between mean fluorescence in positive chambers in dPCR arrays and background fluorescence in negative chambers.</p

Additional file 1: of Use of structured musculoskeletal examination routines in undergraduate medical education and postgraduate clinical practice – a UK survey

Lead Adult Musculoskeletal Tutor Questionnaire. (DOC 54 kb

Multiplex Template Sampling (MTS) strategies.

<p>In the first, “short multiplex”, the sampling rate is raised by ten primer pairs in a multiplexed PCR with a common fluorescent probe for detection. The second method, “long multiplex”, is similar, but loci-specific primers are longer and we append a universal sequence to them. A third method, “repetitive simplex”, uses a single PCR assay designed to target chromosome-specific repetitive sequences.</p

Effect of volume on dPCR reactions.

<p>Performance of same PCR mixes as in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0098341#pone-0098341-g001" target="_blank">Figure 1B</a> in 100 pL volumes. Two multiplexing approaches are compared: short primers and long primers plus a pair of universal primers. Multiplexing level in PCR reactions (horizontal axis) increases from 1× to 10×. Asterisks denote data points where difference between the two approaches was not significant (p = 0.05).</p

Pairs of long and short oligonucleotides used in multiplexed PCR reactions.

<p>Short primers are shown in bold. The first ten pairs target different loci on chromosome 21. The last pair targets RNAse P on chromosome 6. The oligonucleotides used for long multiplex experiments are full sequences listed in the table, with the addition of the universal sequence GACTGACTGCGTAGGTATTATCG (designated as U1 in the table) for forward primers and CACAGGAAACAGCTATGACC (designated as U2 in the table) for the reverse at 5′ end of the primers. The primers used for the repetitive simplex experiments target ten loci on chromosome 21 and were CCTGGTCTGCACCCCAGTG and GTGCAGGAGCTGGTGCAG, and were used with probe #74 (Cat. #04688970001) from the Roche Universal Probe Library which anneals to the CTGCTGCCC motif.</p>*<p>Universal sequences on 5′ ends of long pairs are not shown.</p