Estimation of Carbon Stock in Sungai Merah Protection Forest, Musi Banyuasin Regency of South Sumatra Province

Calculation and estimation of carbon stocks in various types of forests and ecosystems in Indonesia has been widely practiced. However, the availability of carbon stock information for some locations in the remaining forest area in South Sumatra Province is still very limited. This study aim to measuring the carbon storage potential and the ratio between the carbon storage value derived from the interpretation of satellite imagery and the storage of carbon stock from the field calculation. The method used is to calculate the estimation of carbon stock through satellite imagery interpretation and field measurement. The largest estimation of carbon stock through satellite image interpretation was found in secondary forest cover type with yield 896,234 ton/c/ha, followed by plantation land type with a yield of 147.104 ton/c/Ha and the smallest is open land cover with value yield of 2.883 tons/c/ha. While carbon stocks through field measurement yield 429,181 ton/c/ha of secondary forest cover type, followed by plantation land type with 41,169 ton/c/ha and 4,283 ton/c/ha for open land type. A comparison of carbon stock estimates of the two approaches used, yielding a reference value of 220%. These comparative values can be used to assist in carrying out initial estimates of carbon stocks in some types of land cover, especially for lowland forest types

First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

Characterisation of complex polymer mixtures

The polymer of intrinsic microporosity PIM-1 was synthesized following various procedures: (i) from fluoro-monomer by the conventional method, (ii) from fluoro-monomer by a high temperature, high shear mixing method and (iii) from chloro-monomer. For a more complete understanding of the structure of the resultant products of a series of polymerizations under different reaction conditions, a multi-detector gel permeation chromatography (GPC) method was established and validated. A procedure for fractionating PIM-1 using chloroform methanol solvent mixtures was established and validated. A combination of multi-detector GPC and matrix-assisted laser desorption/ionization-time of flight (MALDI-ToF) masss pectrometry was used for the determination of molar mass distribution and to identify structural differences between fractions and between the products from different synthetic procedures. High molar mass samples tended to have broader molar mass distributions. Both Mark-Houwink plots and hydrodynamic volume plots showed deviation from linearity at Mw= 200000 g mol-1, which was attributed to branching. A low cost route for the preparation of PIM-1 from chloro-monomer was successfully established, though samples prepared by this route had broader polydispersities than those prepared from fluoro-monomers. It was found that stable flexible membranes were formed from samples with Mw > 83000 g mol -1. In addition, a comparison of two analytical methods for extraction and determination of additives in HDPE, LLDPE and PP polymers of interest to Saudi Basic Industries Corporation was performed. A comparison of dissolution with ultrasonic assisted extraction methods for the determination of anti-oxidant additives in polyolefins was performed. Ultrasound assisted extraction methods were found to be superior for HDPE and LLDPE, where conventional dissolution was preferred for PP.EThOS - Electronic Theses Online ServiceSaudi Basic Industries Corporation, Chemical Research DepartmentGBUnited Kingdo

Acute compartment syndrome of the hand in Henoch-Schonlein Purpura

An eight year old boy with Henoch-Schonlein Purpura (HSP) presented with acute compartment syndrome (ACS) of his left hand following arterial cannulation of his radial artery in intensive care unit. Emergency decompression and fasciotomy were performed. The authors report this first case in literature and discuss how HSP can be complicated by ACS and ways to prevent the latter from happening

Benchmarking techno-economic performance of greenhouses with different technology levels in a hot humid climate

Greenhouse agriculture is expected to play a critical role in sustainable crop production in the coming decades, opening new markets in climate zones that have been traditionally unproductive for agriculture. Extreme hot and humid conditions, prevalent in rapidly growing economies including the Arabian Peninsula, present unique design and operational challenges to effective greenhouse climate control. These challenges are often poorly understood by local operators and inadequately researched in the literature. This study addresses this knowledge gap by presenting, for the first time, a comprehensive set of benchmarks for water and energy usage, CO2 emissions (CO2e) contribution, and economic performance for low-, mid-, and high-tech greenhouse designs in such climates. Utilising a practical and adaptable model-based framework, the analysis reveals the high-tech design generated the best results for economic return, achieving a 4.9-year payback period with superior water efficiency compared to 5.8 years for low-tech and 7.0 years for mid-tech; however, the high-tech design used significantly more energy to operate its mechanical cooling system, corresponding with higher CO2e per unit area (8.3 and 4.0 times higher than the low- and mid-tech, respectively). These benchmarks provide new insights for greenhouse operators, researchers, and other stakeholders, facilitating the development of effective greenhouse design and operational strategies tailored to meet the challenges of hot and humid climates

Benchmarking techno-economic performance of greenhouses with different technology levels in a hot humid climate

Greenhouse agriculture is expected to play a critical role in sustainable crop production in the coming decades, opening new markets in climate zones that have been traditionally unproductive for agriculture. Extreme hot and humid conditions, prevalent in rapidly growing economies including the Arabian Peninsula, present unique design and operational challenges to effective greenhouse climate control. These challenges are often poorly understood by local operators and inadequately researched in the literature. This study addresses this knowledge gap by presenting, for the first time, a comprehensive set of benchmarks for water and energy usage, CO2 emissions (CO2e) contribution, and economic performance for low-, mid-, and high-tech greenhouse designs in such climates. Utilising a practical and adaptable model-based framework, the analysis reveals the high-tech design generated the best results for economic return, achieving a 4.9-year payback period with superior water efficiency compared to 5.8 years for low-tech and 7.0 years for mid-tech; however, the high-tech design used significantly more energy to operate its mechanical cooling system, corresponding with higher CO2e per unit area (8.3 and 4.0 times higher than the low- and mid-tech, respectively). These benchmarks provide new insights for greenhouse operators, researchers, and other stakeholders, facilitating the development of effective greenhouse design and operational strategies tailored to meet the challenges of hot and humid climates

Are stentless valves hemodynamically superior to stented valves? Long-term follow-up of a randomized trial comparing Carpentier–Edwards pericardial valve with the Toronto Stentless Porcine Valve

ObjectiveThe benefit of stentless valves remains in question. In 1999, a randomized trial comparing stentless and stented valves was unable to demonstrate any hemodynamic or clinical benefits at 1 year after implantation. This study reviews long-term outcomes of patients randomized in the aforementioned trial.MethodsBetween 1996 and 1999, 99 patients undergoing aortic valve replacement were randomized to receive either a stented Carpentier–Edwards pericardial valve (CE) (Edwards Lifesciences, Irvine, Calif) or a Toronto Stentless Porcine Valve (SPV) (St Jude Medical, Minneapolis, Minn). Among these, 38 patients were available for late echocardiographic follow-up (CE, n = 17; SPV, n = 21). Echocardiographic analysis was undertaken both at rest and with dobutamine stress, and functional status (Duke Activity Status Index) was compared at a mean of 9.3 years postoperatively (range, 7.5–11.1 years). Clinical follow-up was 82% complete at a mean of 10.3 years postoperatively (range, 7.5–12.2 years).ResultsPreoperative characteristics were similar between groups. Effective orifice areas increased in both groups over time. Although there were no differences in effective orifice areas at 1 year, at 9 years, effective orifice areas were significantly greater in the SPV group (CE, 1.49 ± 0.59 cm2; SPV, 2.00 ± 0.53 cm2; P = .011). Similarly, mean and peak gradients decreased in both groups over time; however, at 9 years, gradients were lower in the SPV group (mean: CE, 10.8 ± 3.8 mm Hg; SPV, 7.8 ± 4.8 mm Hg; P = .011; peak: CE, 20.4 ± 6.5 mm Hg; SPV, 14.6 ± 7.1 mm Hg; P = .022). Such differences were magnified with dobutamine stress (mean: CE, 22.7 ± 6.1 mm Hg; SPV, 15.3 ± 8.4 mm Hg; P = .008; peak: CE, 48.1 ± 11.8 mm Hg; SPV, 30.8 ± 17.7 mm Hg; P = .001). Ventricular mass regression occurred in both groups; however, no differences were demonstrated between groups either on echocardiographic, magnetic resonance imaging, or biochemical (plasma B-type [brain] natriuretic peptide) assessment (P = .74). Similarly, Duke Activity Status Index scores of functional status improved in both groups over time; however, no differences were noted between groups (CE, 27.5 ± 19.1; SPV, 19.9 ± 12.0; P = .69). Freedom from reoperation at 12 years was 92% ± 5% in patients with CEs and 75% ± 5% in patients with SPVs (P = .65). Freedom from valve-related morbidity at 12 years was 82% ± 7% in patients with CEs and 55% ± 7% in patients with SPVs (P = .05). Finally, 12-year actuarial survival was 35% ± 7% in patients with CEs and 52% ± 7% in patients with SPVs (P = .37).ConclusionAlthough offering improved hemodynamic outcomes, the SPV did not afford superior mass regression or improved clinical outcomes up to 12 years after implantation

Mutation of Arabidopsis copper-containing amine oxidase gene AtCuAOδ alters polyamines, reduces gibberellin content and affects development

Polyamines (PAs) are essential metabolites in plants performing multiple functions during growth and development. Copper-containing amine oxidases (CuAOs) catalyse the catabolism of PAs and in Arabidopsis thaliana are encoded by a gene family. Two mutants of one gene family member, AtCuAOδ, showed delayed seed germination, leaf emergence, and flowering time. The height of the primary inflorescence shoot was reduced, and developmental leaf senescence was delayed. Siliques were significantly longer in mutant lines and contained more seeds. The phenotype of AtCuAOδ over-expressors was less affected. Before flowering, there was a significant increase in putrescine in AtCuAOδ mutant leaves compared to wild type (WT), while after flowering both spermidine and spermine concentrations were significantly higher than in WT leaves. The expression of GA (gibberellic acid) biosynthetic genes was repressed and the content of GA1, GA7, GA8, GA9, and GA20 was reduced in the mutants. The inhibitor of copper-containing amine oxidases, aminoguanidine hydrochloride, mimicked the effect of AtCuAOδ mutation on WT seed germination. Delayed germination, reduced shoot height, and delayed flowering in the mutants were rescued by GA3 treatment. These data strongly suggest AtCuAOδ is an important gene regulating PA homeostasis, and that a perturbation of PAs affects plant development through a reduction in GA biosynthesis