Bio-nanotechnology application in wastewater treatment

The nanoparticles have received high interest in the field of medicine and water purification, however, the nanomaterials produced by chemical and physical methods are considered hazardous, expensive, and leave behind harmful substances to the environment. This chapter aimed to focus on green-synthesized nanoparticles and their medical applications. Moreover, the chapter highlighted the applicability of the metallic nanoparticles (MNPs) in the inactivation of microbial cells due to their high surface and small particle size. Modifying nanomaterials produced by green-methods is safe, inexpensive, and easy. Therefore, the control and modification of nanoparticles and their properties were also discussed

Estimation of Carbon Stock in Sungai Merah Protection Forest, Musi Banyuasin Regency of South Sumatra Province

Calculation and estimation of carbon stocks in various types of forests and ecosystems in Indonesia has been widely practiced. However, the availability of carbon stock information for some locations in the remaining forest area in South Sumatra Province is still very limited. This study aim to measuring the carbon storage potential and the ratio between the carbon storage value derived from the interpretation of satellite imagery and the storage of carbon stock from the field calculation. The method used is to calculate the estimation of carbon stock through satellite imagery interpretation and field measurement. The largest estimation of carbon stock through satellite image interpretation was found in secondary forest cover type with yield 896,234 ton/c/ha, followed by plantation land type with a yield of 147.104 ton/c/Ha and the smallest is open land cover with value yield of 2.883 tons/c/ha. While carbon stocks through field measurement yield 429,181 ton/c/ha of secondary forest cover type, followed by plantation land type with 41,169 ton/c/ha and 4,283 ton/c/ha for open land type. A comparison of carbon stock estimates of the two approaches used, yielding a reference value of 220%. These comparative values can be used to assist in carrying out initial estimates of carbon stocks in some types of land cover, especially for lowland forest types

First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

Cultura de Inovação: Conceitos e Modelos Teóricos

This study portrays the state of the art in scientific literature on the culture of innovation, with the objective of characterizing its meaning and especially describing different theoretical models that seek to understand how it occurs in an organizational environment. To enrich the analysis, research results show the relationship between organizational culture and innovation. The literature review was carried out in 2011 using the following databases: Coordination for the Improvement of Higher Education Personnel (CAPES), Proquest and Directory of Open Access Journals (DOAJ). The keywords used were the expression culture of innovation and the joint terms culture and innovation, only full articles were included in the research. Culture of innovation articles that were cited in the papers identified in the literature search were also considered. The analysis consisted of 40 articles, based on the predefined criteria, and showed that this is a topic of interest for researchers in different world regions. It is a complex theme determined by factors with a systemic character. There is a predominance of quantitative research and strong evidence of a relationship between organizational culture and innovation, which requires further research to test the theoretical models proposed by these different authors

β-hairpin-mediated formation of structurally distinct multimers of neurotoxic prion peptides

Protein misfolding disorders are associated with conformational changes in specific proteins, leading to the formation of potentially neurotoxic amyloid fibrils. During pathogenesis of prion disease, the prion protein misfolds into β-sheet rich, protease-resistant isoforms. A key, hydrophobic domain within the prion protein, comprising residues 109–122, recapitulates many properties of the full protein, such as helix-to-sheet structural transition, formation of fibrils and cytotoxicity of the misfolded isoform. Using all-atom, molecular simulations, it is demonstrated that the monomeric 109–122 peptide has a preference for α-helical conformations, but that this peptide can also form β-hairpin structures resulting from turns around specific glycine residues of the peptide. Altering a single amino acid within the 109–122 peptide (A117V, associated with familial prion disease) increases the prevalence of β-hairpin formation and these observations are replicated in a longer peptide, comprising residues 106–126. Multi-molecule simulations of aggregation yield different assemblies of peptide molecules composed of conformationally-distinct monomer units. Small molecular assemblies, consistent with oligomers, comprise peptide monomers in a β-hairpin-like conformation and in many simulations appear to exist only transiently. Conversely, larger assemblies are comprised of extended peptides in predominately antiparallel β-sheets and are stable relative to the length of the simulations. These larger assemblies are consistent with amyloid fibrils, show cross-β structure and can form through elongation of monomer units within pre-existing oligomers. In some simulations, assemblies containing both β-hairpin and linear peptides are evident. Thus, in this work oligomers are on pathway to fibril formation and a preference for β-hairpin structure should enhance oligomer formation whilst inhibiting maturation into fibrils. These simulations provide an important new atomic-level model for the formation of oligomers and fibrils of the prion protein and suggest that stabilization of β-hairpin structure may enhance cellular toxicity by altering the balance between oligomeric and fibrillar protein assemblies

Characterisation of complex polymer mixtures

The polymer of intrinsic microporosity PIM-1 was synthesized following various procedures: (i) from fluoro-monomer by the conventional method, (ii) from fluoro-monomer by a high temperature, high shear mixing method and (iii) from chloro-monomer. For a more complete understanding of the structure of the resultant products of a series of polymerizations under different reaction conditions, a multi-detector gel permeation chromatography (GPC) method was established and validated. A procedure for fractionating PIM-1 using chloroform methanol solvent mixtures was established and validated. A combination of multi-detector GPC and matrix-assisted laser desorption/ionization-time of flight (MALDI-ToF) masss pectrometry was used for the determination of molar mass distribution and to identify structural differences between fractions and between the products from different synthetic procedures. High molar mass samples tended to have broader molar mass distributions. Both Mark-Houwink plots and hydrodynamic volume plots showed deviation from linearity at Mw= 200000 g mol-1, which was attributed to branching. A low cost route for the preparation of PIM-1 from chloro-monomer was successfully established, though samples prepared by this route had broader polydispersities than those prepared from fluoro-monomers. It was found that stable flexible membranes were formed from samples with Mw > 83000 g mol -1. In addition, a comparison of two analytical methods for extraction and determination of additives in HDPE, LLDPE and PP polymers of interest to Saudi Basic Industries Corporation was performed. A comparison of dissolution with ultrasonic assisted extraction methods for the determination of anti-oxidant additives in polyolefins was performed. Ultrasound assisted extraction methods were found to be superior for HDPE and LLDPE, where conventional dissolution was preferred for PP.EThOS - Electronic Theses Online ServiceSaudi Basic Industries Corporation, Chemical Research DepartmentGBUnited Kingdo

Erratum to: 36th International Symposium on Intensive Care and Emergency Medicine

[This corrects the article DOI: 10.1186/s13054-016-1208-6.]

Acute compartment syndrome of the hand in Henoch-Schonlein Purpura

An eight year old boy with Henoch-Schonlein Purpura (HSP) presented with acute compartment syndrome (ACS) of his left hand following arterial cannulation of his radial artery in intensive care unit. Emergency decompression and fasciotomy were performed. The authors report this first case in literature and discuss how HSP can be complicated by ACS and ways to prevent the latter from happening