Photoreceptor protein expression in GCAP1^−/− retina.

<p><b>A.</b> Immunoblots of SDS polyacrylamide gels containing samples from WT and GCAP1 KO retinas probed with antibodies raised against GCAP2, RetGC1, RetGC2, rod α-transducin (Gtα1), PDE6, arrestin 1 (ARR), GRK1, RGS9, and β-actin, as indicated. <b>B.</b> Average (± SD) integrated chemiluminescence signal intensity in the band for the corresponding antigen in GCAP1^−/− retina relative to the WT for GCAP1 (n = 5), GCAP2 (n = 7), RetGC1 (n = 3), RetGC2 (n = 3), rod α-transducin (n = 3), PDE6 (n = 3), arrestin (n = 3), GRK1 (n = 3), RGS9 (n = 3), and β-actin (n = 3). When compared by one-way ANOVA with Bonferroni’s <i>post hoc</i> test (alpha = 0.01), there were significant differences found in GCAP1 (**) and GCAP2 (*) contents (P<0.0001 and P<0.006, respectively), but not in other tested proteins.</p

Recovery of bright flash response of rods, reconstructed from recordings of paired-flash ERGs.

<p><b>A.</b> Fractional a-wave recovery from a strong flash, presented at time zero, in paired-flash ERGs from 16 WT (•) <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone.0047637-Olshevskaya1" target="_blank">[22]</a>, 17 GCAPs1,2^−/− (▵), and 17 GCAP1^−/− (○) mice aged 1.5–3 months. <b>B.</b> The recovery remained fast in the absence of each RetGC isozyme; 16 WT (•), 17 GCAP1^−/− (○), 18 RetGC1^−/−GCAP1^−/− (⋄), and 17 RetGC2^−/−GCAP1^−/− (□) mice. The average saturating a-wave amplitudes in WT, GCAP1^−/−, GCAPs1,2^−/−, RetGC1^−/−GCAP1^−/−, and RetGC2^−/−GCAP1^−/− were 532, 347, 365, 98, and 277 µV, respectively. The continuous curves were ‘smooth line’ fit by KaleidaGraph software. In many cases, only the initial phase of the ERG recovery could be fit by a single exponential. The time required for 50% amplitude recovery determined from the exponential portion of the fit in 16 mice for each genotype was (mean ± SEM): 0.55±0.02, 0.51±0.02, 0.50±0.02, 0.51±0.02, and 1.78±0.06 s in WT, GCAP1^−/−, RetGC1^−/−GCAP1^−/−, RetGC2^−/−GCAP1^−/−, and GCAPs12^−/−, respectively. In all-pairs comparison, the only significant difference for the entire group (P<0.0001, one way ANOVA with a Bonferroni post-hoc test, alpha = 0.01) was found between GCAPs1,2^−/− and all other genotypes. Contribution of a small fraction <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone.0047637-Jeon1" target="_blank">[45]</a> of mouse cones to the scotopic a-wave amplitude was considered insignificant for this analysis.</p

Changes in flash responses after deletion of GCAP1.

<p>Averaged flash responses of a WT rod (<b>A</b>) peaked sooner and had a reduced tail component in the recovery compared to two GCAP1^−/−rods designated arbitrarily as having “fast” (<b>B</b>) or “slow” (<b>C</b>) response kinetics (marked accordingly as “fast” and “slow” in the panels). Maximal response amplitudes were 11, 10 and 14 pA, respectively. The integration times of dim flash responses, whose amplitudes were less than 20% of the maximal response, were 250 ms for the WT rod and 236 and 483 ms for the two GCAP1^−/− rods. The flash was presented at time zero. Flash strengths were: 14, 31, 58, 121, 227, 505, 945, 1973 and 3691 photons µm⁻² for the WT rod; 6, 11, 23, 44, 91, 171, 380, 713, 1482, 2773 and 6091 photons µm⁻² for the GCAP1^−/− rod in <b>B</b> and 3, 5, 20, 80, 311, 692, 1300, 2691 and 5045 photons µm⁻² for the GCAP1^−/− rod in <b>C.</b> Records were digitally filtered at 12 Hz. <b>D.</b> Stepped recovery of the bright flash response in two trials for the WT rod in <b>A</b> due to aberrant photon responses. Flash strength was 3691 photons µm⁻². The number of steps and the temporal depth of their tread varied randomly from trial to trial. <b>E.</b> Tendency for steps to be larger in GCAP1^−/− rods. Responses were recorded from a GCAP1^−/− rod different from those in <b>B</b> and <b>C.</b> Flash strength was 2773 photons µm⁻². Records were digitally filtered at 8 Hz. <b>F.</b> Average stimulus-response relations for 28 WT (<i>black</i>) and 36 GCAP1^−/− (<i>red</i>) rods. Each circle averages the normalized responses of several rods that were grouped by similar flash strength, and error bars show SEM. Continuous lines show the saturating exponential function <i>r/r_max = 1− exp(-ki)</i>, where <i>i</i> is flash strength, <i>k</i> is equal to ln(2)/i_0.5, and <i>i_0.5</i> is the flash strength that produces a half-saturating response, with i_0.5 values of 66 and 23 photons µm⁻² for WT and GCAP1^−/−, respectively. These i_0.5 values were derived from the mean <i>k</i> from fits to individual WT and GCAP1^−/− rods. <b>G.</b> Stimulus-response relations for the tail of saturated responses from 16 WT (<i>black</i>) and 35 GCAP1^−/− (<i>red</i>) rods, measured at 1.5 (<i>thick symbols</i>) and 2 s (<i>thin symbols</i>) after the flash. Each symbol represents the average, normalized response amplitude of 12 to 15 WT rods or 24 to 30 KO rods (except at the lowest and highest flash strengths, for which there were only 1–6 rods), where groups were made according to flash strength. Error bars for flash strength are shown although variation was negligible on a log scale. Continuous lines show saturating exponential functions with averaged values for <i>k</i> (see above) derived from fits to individual rods. <b>H.</b> Pepperberg plot <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone.0047637-Pepperberg1" target="_blank">[34]</a> for 11 WT (<i>black</i>) and 28 GCAP1^−/− (<i>red</i>) rods. The saturation time of a bright flash response was measured from mid-flash to the point at which the saturation response declined to 0.8 r_max, i.e., 20% recovery, as demarcated by the dotted lines in <b>A–C</b>. Results from each rod were plotted with a different symbol. The continuous lines have slopes equal to τ_c of 191 ms for WT and 159 ms for GCAP1^−/−, that were the mean values of linear regressions from individual rods in each group (<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone-0047637-t002" target="_blank"><b>Table 2</b></a>).</p

Model for the disease mechanism in the GCAP1 mutant mice and the impact of light exposure.

<p>Intracellular calcium is elevated in the dark, but falls to the normal minimum in the light. Hence the dark state presents a pathogenic condition but the light state does not. Prolongation of the light phase at the expense of the dark phase is predicted to enhance photoreceptor survival.</p

Rod outer segment morphology.

<p>Measurements were made on rods from the central retina of 2 or 3 mice of each type, aged 2–3 months (representative sections are shown in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone-0047637-g002" target="_blank"><b>Fig. 2F, G</b></a>). Data are given as mean ± SEM, (number of rods measured, P-value from a t-test for values less than 0.05).</p

Altered RetGC activity in GCAP1^−/− mouse retinas.

<p>Total (<b>A)</b> and normalized (<b>B</b>) cGMP synthetic activity in WT (•, n = 5) and GCAP1^−/− (○, n = 4) retinas as a function of free Ca²⁺ concentration. Notice that sensitivity shifted to lower levels of Ca²⁺ in GCAP1^−/− retinas. In panel <b>B</b>, the activities in each series were normalized by the corresponding maximal RetGC activity measured in each genotype and averaged for each group. The data were fitted by the equation, <i>A = (A_max – A_min)/(1+([Ca]/[Ca]_1/2)^h) + A_min</i>; where <i>A_max</i> and <i>A_min</i> are the maximal and the minimal activity of guanylyl cyclase, respectively, <i>[Ca]_1/2</i> is the concentration of Ca²⁺ producing 50% inhibition, and <i>h</i> is a Hill coefficient. RetGC activity was assayed as described in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#s2" target="_blank">Materials and Methods</a>. A_max values for the WT and GCAP1^−/− retinas were 0.6 and 0.8 nmol cGMP min⁻¹ retina⁻¹, [Ca]_1/2 values were 81 and 46 nM, and <i>h</i> values were 1.8 and 1.6, respectively.</p

Preservation of retinal function by constant light.

<p>(A) The L52H line of mutant mice were raised from birth under cyclic lighting until 3 weeks of age, when they were switched to constant light or constant darkness and kept for an additional three months. Dark-adapted, full-field ERGs with 10 µsec flashes of white light (4.3 log ft-L) were elicited in a Ganzfeld dome. ERG a- and b-waves represent the activities of photoreceptors and inner retinal neurons, respectively. In mutant mice kept under constant light, the a-wave amplitude of 271±29 µV (mean±SEM) was well within the range for age-matched cyclic light reared WT mice (258±15 µV), while the b-wave amplitude of 654±68 µV was slightly below the WT average of 837±68 µV (n = 6 each). Under dark-rearing conditions, the a- and b-wave amplitudes declined to 72±6 µV and 318±40 µV (n = 5), respectively. The ERG a- and b-wave amplitudes in mice kept in constant light were significantly higher than those kept in the dark (<i>P<0.003</i>). (B) Representative dark-adapted, rod dominant ERG waveforms recorded from GCAP1 mutant mice reared in dark or light for 3 months, as well as waveforms from an age matched WT mouse.</p

Heterogeneity in WT and GCAP1^−/− rods.

<p><b>A.</b> The dim flash response, whose amplitude was less than 20% of the maximal response, was scaled to the amplitude of the SPR for each rod and averaged for 18 WT (<i>solid black trace</i>), 36 GCAP1^−/− (<i>red trace</i>), and 11 GCAPs1,2^−/− (<i>blue trace</i>) rods. Traces were digitally filtered at 12 Hz. Although the SPR amplitude and time-to-peak of GCAP1^−/− rods were twice those of WT, the averaged response of GCAP1^−/− could not reflect the wide range of characteristics of the group. <b>B.</b> Increase in the SPR amplitude with integration time for GCAP1^−/− rods (Ο, <i>red</i>) but not for WT rods (○, <i>black</i>) or for GCAPs1,2^−/− rods (Δ, <i>blue</i>). Dotted horizontal and vertical lines demarcate the mean SPR amplitudes and integration times, respectively for WT (<i>black</i>) and GCAP1^−/− rods (<i>red</i>). <i>Solid red line</i> was linear fit for GCAP1^−/− rods; the Pearson product-moment correlation coefficient was 0.71. <b>C–F</b>, SPRs for selected groups of WT (<i>black</i>) and GCAP1^−/− (<i>red</i>) rods that were designated arbitrarily as having fast (<b>C</b>), medium (<b>D</b>) or slow (<b>E</b>) integration times. The rods with fast, medium and slow integration times have symbols marked with “<b>–</b>”, “<b>×</b>” and “<b>+</b>” in <b>B</b>, respectively. Responses from all groups were gathered in <b>F</b>, along with that of GCAPs1,2^−/− (from <b>A</b>). For WT rods, times to peak were 138, 135 and 163 ms for groups with fast, medium and slow integration time, respectively, but the SPR amplitudes remained similar: 0.5, 0.4 and 0.5 pA. For GCAP1^−/− rods, the mean SPR times-to-peak were 195, 225 and 333 ms and the SPR amplitudes were 0.6, 0.9 and 1.8 pA, respectively. The SPR in GCAPs1,2^−/− rods had a time-to-peak of 380 ms and an amplitude of 2.3 pA.</p

Strategy for GCAP1 gene disruption.

<p><b>A.</b> Schematic of the mouse <i>GUCA1A</i> gene disruption. The targeting construct was made by inserting the <i>PGK:Neo:tts</i> cassette <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone.0047637-Tybulewicz1" target="_blank">[23]</a> between PCR-amplified 1.5-kb and 5-kb arms to replace the first exon of the <i>GUCA1A</i> gene together with the putative promoter region and a part of the first intron as described in detail in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#s2" target="_blank">Materials and Methods</a>. <i>K, M, N,</i> and <i>S</i> designate KpnI, MluI, NotI and SbfI restriction sites, respectively; <i>tts</i> – transcription termination site in <i>PGK:Neo</i> cassette. <b>B.</b> PCR products of WT allele (<i>top</i>) and the targeted KO allele (<i>bottom</i>), amplified from mouse tail DNA from littermates produced by breeding of GCAP1^+/− parents using f3 (5′-CCTTGTGCAGGGGACATTAGAAAATAAG) and r3 (5′-CATCTGTTCCACATA CTGGCTGGCT) primers or f2 (5′- TGATATTGCTGAAGAGCTTGGCGGCGAAT) and r3 primers, respectively. <b>C.</b> Immunoblotting of SDS polyacrylamide gels containing retina samples from WT, GCAP1^+/−, and GCAP1^−/− littermates simultaneously probed with anti-rhodopsin and anti-GCAP1 polyclonal antibody. Retinas were homogenized in SDS sample buffer on ice and were not boiled prior to electrophoresis, in order to preserve rhodopsin monomer. <b>D.</b> GCAP immunofluorescence in retina cryosections from WT (<i>left panels</i>) and GCAP1^−/− (<i>right panels</i>) mice probed with anti-GCAP1 (<i>upper panels</i>) or anti-GCAP2 (<i>bottom panels</i>) polyclonal antibody and developed with goat-anti rabbit FITC-labeled antibody. WT and GCAP1^−/− retinas were fixed, processed and probed with each antibody under identical conditions; images were taken using identical laser settings and image acquisition parameters. One half of each panel also shows the anti-GCAP FITC fluorescence and nuclei counterstained with TO-PRO-3 iodide (<i>pseudo-blue</i>), superimposed on the DIC image of the same view field. Notice that the brightness of the anti-GCAP2 signal in the outer segment layer <i>versus</i> inner segment layer is slightly increased in the GCAP1^−/− retinas (marked with the dashed lines in <i>lower two panels</i>). <b>E.</b> Hematoxylin/eosin-stained GCAP1^−/− retinas at 6 months of age did not reveal evidence for retinal degeneration or other histological abnormalities when compared to the WT of the same age. Histological layers of the retina in <b>D</b> and <b>E</b> are marked as: <i>RPE</i>– retinal pigment epithelium, <i>OS</i>– photoreceptor outer segments, <i>IS</i>– inner segments, <i>ON</i>– outer nuclear layer, <i>OP</i>– outer plexiform layer, <i>IN</i>– inner nuclear layer, <i>IP</i> – inner plexiform layer, <i>GC</i> – ganglion cell layer. <b>F, G.</b> Representative electron micrographs of the WT and GCAP1^−/− ROS morphology: cross-sections (<b>F</b>; bar size –1 µm) and radial sections (<b>G</b>; bar size –0.2 µm); negative contrast by osmium.</p

Rod photoresponse parameters in WT and GCAP1^−/− mice.

<p>Parameters for both WT and GCAP1^−/− mice average all rods of each type and include “fast” and “slow” rods (see <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone-0047637-g005" target="_blank"><b>Figures 5</b></a> and <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone-0047637-g006" target="_blank"><b>6</b></a> and the <i>Discussion</i> section). Results are given as mean ± SEM (number of cells recorded, P-value from a Student’s t-test for values less than 0.05). The i_0.5 is the flash strength at 500 nm eliciting a half-maximal response, and it varies inversely with sensitivity. SPR amplitude was estimated by dividing the ensemble variance by the mean dim flash response amplitude. Kinetics of the single-photon response were determined from dim flash responses whose amplitude was less than 20% of the maximum. Time to peak was measured from mid-flash to the response peak. Integration time was calculated as the integral of the response divided by response amplitude. Recovery time constant, τ_r, refers to a fit of the final falling phase of the dim flash response with a single exponential. Saturation time constant, τ_c, is the slope of the relation between saturation time and the natural logarithm of the flash strength, by linear regression. R_max is the maximum circulating current recorded from a rod, and fractional amplitude is taken as a ratio of the single-photon-response amplitude to the maximum circulating current from that rod.</p