Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

The cAMP effector EPAC activates Elk1 transcription factor in prostate smooth muscle, and is a minor regulator of alpha 1-adrenergic contraction

Background: Prostate smooth muscle tone is regulated by alpha 1-adrenoceptor-induced contraction and cAMP-mediated relaxation. EPAC is an effector of cAMP, being involved in smooth muscle relaxation and cell cycle control outside the lower urinary tract. Here, we investigated the expression and function of EPAC in human prostate tissues from patients undergoing radical prostatectomy. Results: mRNA and protein expression of EPAC was detected in all prostate tissues by RT-PCR and Western blot analysis. Immunoreactivity was observed in stromal cells, and colocalized with immunofluorescence for a-smooth muscle actin and calponin. Under normal conditions, noradrenaline-or phenylephrine-induced contraction of prostate strips in the organ bath was not affected by the EPAC activator pCPT (SP-8-pCPT-2'-O-Me-cAMPS.NA) (30 mu M). However, when the cyclooxygenase inhibitor indomethacin (50 mu M) was added, EPAC activators pCPT and OME (8-CPT-2'-O-Me-cAMP.Na) (30 mu M) significantly reduced contractions by low concentrations of phenylephrine. These effects were not observed on noradrenaline-induced contraction. OME and pCPT caused phosphorylation of the transcription factor Elk1 in prostate tissues. Elk1 activation was confirmed by EMSA (electrophoretic mobility shift assay), where OME and pCPT incresed Elk1 binding to a specific DNA probe. Conclusions: EPAC activation may reduce alpha 1-adrenergic prostate contraction in the human prostate, although this effect is masked by cyclooxygenases and beta-adrenoceptors. A main EPAC function in the human prostate may be the regulation of the transcription factor Elk1

Living systematic review and meta-analysis of the prostate MRI diagnostic test with Prostate Imaging Reporting and Data System (PI-RADS) assessment for the detection of prostate cancer:study protocol

INTRODUCTION: The Prostate Imaging Reporting and Data System (PI-RADS) standardises reporting of prostate MRI for the detection of clinically significant prostate cancer. We provide the protocol of a planned living systematic review and meta-analysis for (1) diagnostic accuracy (sensitivity and specificity), (2) cancer detection rates of assessment categories and (3) inter-reader agreement. METHODS AND ANALYSIS: Retrospective and prospective studies reporting on at least one of the outcomes of interest are included. Each step that requires literature evaluation and data extraction is performed by two independent reviewers. Since PI-RADS is intended as a living document itself, a 12-month update cycle of the systematic review and meta-analysis is planned. This protocol is in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses—Protocols statement. The search strategies including databases, study eligibility criteria, index and reference test definitions, outcome definitions and data analysis processes are detailed. A full list of extracted data items is provided. Summary estimates of sensitivity and specificity (for PI-RADS ≥3 and PI-RADS ≥4 considered positive) are derived with bivariate binomial models. Summary estimates of cancer detection rates are calculated with random intercept logistic regression models for single proportions. Summary estimates of inter-reader agreement are derived with random effects models. ETHICS AND DISSEMINATION: No original patient data are collected, ethical review board approval, therefore, is not necessary. Results are published in peer-reviewed, open-access scientific journals. We make the collected data accessible as supplemental material to guarantee transparency of results. PROSPERO REGISTRATION NUMBER: CRD42022343931

Patient-Reported Side Effects of Intradetrusor Botulinum Toxin Type A for Idiopathic Overactive Bladder Syndrome

Objective: The aim of the study was a prospective assessment of patient-reported side effects in an open-label study after intradetrusor botulinum toxin injections for idiopathic overactive bladder (OAB). Patients and Methods: Botulinum toxin A injection was performed in 56 patients with idiopathic OAB. Patients were followed up for 6 months concerning side effects and patients' satisfaction. Results: Different types of side effects were assessed such as dry mouth (19.6%), arm weakness (8.9%), eyelid weakness (8.9%), leg weakness (7.1%), torso weakness (5.4%), impaired vision (5.4%) and dysphagia (5.4%). In all cases, symptoms were mild and transient. Urological complications such as gross hematuria (17.9%), acute urinary retention (8.9%) and acute urinary tract infection (7.1%) were noticed. In all cases, acute urinary retention was transient and treated with temporary intermittent self-catheterization. There was no statistically significant correlation between dosage and observed side effects. Patients' satisfaction rate was high (71.4%). Conclusion: Intradetrusor injection of botulinum toxin was associated with a high rate of neurourological side effects. In general, side effects were transient, mild and did not require special treatment. Copyright (C) 2010 S. Karger AG, Base

Inhibition of Female and Male Human Detrusor Smooth Muscle Contraction by the Rac Inhibitors EHT1864 and NSC23766

Introduction: Lower urinary tract symptoms (LUTS) due to overactive bladder (OAB) are caused by spontaneous detrusor contractions. Medical treatment with muscarinic receptor antagonists or β3-adrenoceptor agonists aims to inhibit detrusor contractions, but overall results are unsatisfactory. Consequently, improved understanding of bladder smooth muscle contraction and identification of novel compounds for its inhibition are needed to develop alternative options. A role of the GTPase Rac1 for smooth muscle contraction has been reported from the prostate, but is unknown in the human detrusor. Here, we examined effects of the Rac inhibitors NSC23766, which may also antagonize muscarinic receptors, and EHT1864 on contraction of human detrusor tissues. Methods: Female and male human detrusor tissues were obtained from radical cystectomy. Effects of NSC23766 (100 µM) and EHT1864 (100 µM) on detrusor contractions were studied in an organ bath. Results: Electric field stimulation induced frequency-dependent contractions of detrusor tissues, which were inhibited by NSC23766 and EHT1864. Carbachol induced concentration-dependent contractions. Concentration response curves for carbachol were shifted to the right by NSC23766, reflected by increased EC50 values, but unchanged Emax values. EHT1864 reduced carbachol-induced contractions, resulting in reduced Emax values for carbachol. The thromboxane analog U46619 induced concentration-dependent contractions, which remained unchanged by NSC23766, but were reduced by EHT1864. Conclusions: NSC23766 and EHT1864 inhibit female and male human detrusor contractions. NSC23766, but not EHT1864 competitively antagonizes muscarinic receptors. In addition to neurogenic and cholinergic contractions, EHT1864 inhibits thromboxane A2-induced detrusor contractions. The latter may be promising, as the origin of spontaneous detrusor contractions in OAB is noncholinergic. In vivo, both compounds may improve OAB-related LUTS

Real-world data and treatment patterns of patients with lower urinary tract symptoms due to benign prostatic hyperplasia in Germany:an observational study using health insurance claims data

Purpose Benign prostatic hyperplasia (BPH) is associated with lower urinary tract symptoms (LUTS), representing one of the most common urological conditions. However, insights into the actual healthcare of this patient cohort in Germany are scarce. We aimed to retrospectively analyse management patterns of patients with LUTS in Germany using health insurance claims databases. Methods A retrospective, longitudinal cohort analysis was conducted obtaining claims data from the German InGef health insurance database containing approximately five million member-records from over 60 nationwide statutory health insurances. First, a cross-sectional prevalence analysis was performed on all individuals with a diagnosis on LUTS (ICD-10 GM N40) in 2018. Second, a longitudinal analysis of individuals with either a newly started BPH medication or initial BPH surgery who were indexed in 2014 and followed-up for 4 years. Results In 2018, 132,386 (6.7%) prevalent BPH patients were identified from 1,979,916 continuously insured males. A potential overcoding bias could not be assessed which may influence the outpatient sector estimation. 10,361 (0.7%) patients were identified with incident BPH medication and 1768 (0.1%) patients with incident BPH surgery out of 1,575,604 males (2013-2018). Alpha-blockers were the drug of choice (95.6%) in the first year. Half of patients received specific BPH medications four years after index, while almost 98% of initial BPH surgeries were performed within the inpatient setting. TURP was the most frequent surgical intervention (76%). Conclusions A widespread diffusion of alternative individualized minimally invasive approaches in the outpatient sector might address pharmacotherapy discontinuation and patient-access barriers to other treatments

Ghrelin Aggravates Prostate Enlargement in Rats with Testosterone-Induced Benign Prostatic Hyperplasia, Stromal Cell Proliferation, and Smooth Muscle Contraction in Human Prostate Tissues

Epidemiologic studies revealed a context between lower urinary tract symptoms (LUTS) suggestive of benign prostatic hyperplasia (BPH) and metabolic syndrome. However, molecular mechanisms underlying this relationship are largely unknown. Prostate enlargement and increased prostate smooth muscle tone are important factors in the pathophysiology of LUTS suggestive of BPH. In the present study, we studied effects of the metabolic hormone ghrelin on prostate enlargement in rats with experimentally induced BPH, growth of cultured stromal cells from human prostate (WPMY-1), and smooth muscle contraction of human prostate tissues. Ghrelin (20 nmol/kg daily, p.o., 2 weeks) increased prostate size in rats with testosterone-induced BPH. Microarray identified 114 ghrelin-upregulated genes (2-fold or more) in these prostates, with possible roles in growth, smooth muscle contraction, or metabolism. 12 genes were selected for further analyses. In human prostate tissues, mRNA levels of 11 of them correlated positively with ghrelin receptor (GHSR) expression, but only two with the degree of BPH. Accordingly, no correlation was evident between GHSR expression level and BPH in human prostate tissues. In WPMY-1 cells, the GHRS agonist MK0677 upregulated 11 of the selected genes. MK0677 induced proliferation of WPMY-1 cells, shown by EdU assay, colony formation, proliferation markers, flow cytometry, and viability. In myographic measurements, GHSR agonists enhanced contractions of human prostate strips. Together, ghrelin may aggravate prostate enlargement, stromal cell growth, and prostate smooth muscle contraction in BPH. Ghrelin may deteriorate urethral obstruction independently from BPH, qualifying the ghrelin system as an attractive new target to be tested for LUTS treatment in BPH

A comparative assessment of prostate positioning guided by three-dimensional ultrasound and cone beam CT

Background: The accuracy of the Elekta Clarity (TM) three-dimensional ultrasound system (3DUS) was assessed for prostate positioning and compared to seed-and bone-based positioning in kilo-voltage cone-beam computed tomography (CBCT) during a definitive radiotherapy. Methods: The prostate positioning of 6 patients, with fiducial markers implanted into the prostate, was controlled by 3DUS and CBCT. In total, 78 ultrasound scans were performed trans-abdominally and compared to bone-matches and seed-matches in CBCT scans. Setup errors detected by the different modalities were compared. Systematic and random errors were analysed, and optimal setup margins were calculated. Results: The discrepancy between 3DUS and seed-match in CBCT was -0.2 +/- 2.7 mm laterally,-1.9 +/- 2.3 mm longitudinally and 0.0 +/- 3.0 mm vertically and significant only in longitudinal direction. Using seed-match as reference, systematic errors of 3DUS were 1.3 mm laterally, 0.8 mm longitudinally and 1.4 mm vertically, and random errors were 2.5 mm laterally, 2.3 mm longitudinally, and 2.7 mm vertically. No significant difference could be detected for 3DUS in comparison to bone-match in CBCT. Conclusions: 3DUS is feasible for image guidance for patients with prostate cancer and appears comparable to CBCT based image guidance in the retrospective study. While 3DUS offers some distinct advantages such as no need of invasive fiducial implantation and avoidance of extra radiation, its disadvantages include the operator dependence of the technique and dependence on sufficient bladder filling. Further study of 3DUS for image guidance in a large patient cohort is warranted

What Is the Required Certainty of Evidence for the Implementation of Novel Techniques for the Treatment of Benign Prostatic Obstruction?

Peer reviewedPostprin