Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer

Investigation of chemical constituents of Eranthis longistipitata (Ranunculaceae): coumarins and furochromones

Aqueous‐ethanol extracts (70%) from the leaves of Eranthis longistipitata Regel. (Ranunculaceae Juss.)—collected from natural populations of Kyrgyzstan—were studied by liquid chromatography with high‐resolution mass spectrometry (LC‐HRMS). There was no variation of the metabolic profiles among plants that were collected from different populations. More than 160 compounds were found in the leaves, of which 72 were identified to the class level and 58 to the individual‐ compound level. The class of flavonoids proved to be the most widely represented (19 compounds), including six aglycones [quercetin, kaempferol, aromadendrin, 6‐methoxytaxifolin, phloretin, and (+)‐catechin] and mono‐ and diglycosides (the other 13 compounds). In the analyzed samples of E. longistipitata, 14 fatty acid–related compounds were identified, but coumarins and furochromones that were found in E. longistipitata were the most interesting result; furochromones khelloside, khellin, visnagin, and cimifugin were found in E. longistipitata for the first time. Coumarins 5,7‐dihydroxy‐4‐methylcoumarin, scoparone, fraxetin, and luvangetin and furochromones methoxsalen, 5‐O‐methylvisammioside, and visamminol‐3′‐O‐glucoside were detected for the first time in the genus Eranthis Salisb. For all the above compounds, the structural formulas are given. Furthermore, detailed information (with structural formulas) is provided on the diversity of chromones and furochromones in other representatives of Eranthis. The presence of chromones in plants of the genus Eranthis confirms its closeness to the genus Actaea L. because chromones are synthesized by normal physiological processes only in these members of the Ranunculaceae family

Parallel Reaction Monitoring Mode for Atenolol Quantification in Dried Plasma Spots by Liquid Chromatography Coupled with High-Resolution Mass Spectrometry

In this study, we reported a rapid, sensitive, robust, and validated method for atenolol quantification in dried plasma spots (DPS) by liquid chromatography with high-resolution mass spectrometry (LC-HRMS) using parallel reaction monitoring mode (PRM). Aliquots of 25 µL human plasma were placed onto Whatman 903 Cards and air-dried. Disks (3.2 mm internal diameter) were punched, and a 100 µL working internal standard solution was added to each sample and then incubated on a shaker for 15 min at 40 °C, followed by rapid centrifugation (10,000× g, 10 s). The supernatant was transferred into 300 µL vials for subsequent LC–HRMS analysis. After chromatographic separation, atenolol and the internal standard were quantified in positive-ion parallel reaction monitoring mode by detection of all target product ions at 10 ppm tolerances. The total time of the analysis was 5 min. The calibration curve was linear in the range of 5–1000 ng/mL with interday and intraday precision levels and biases of <14.4%, and recovery was 62.9–81.0%. The atenolol in DPS was stable for ≥30 days at 25 and 4 °C. This fully validated method is selective and suitable for atenolol quantitation in DPS using LC–HRMS

Application of Parallel Reaction Monitoring to the Development and Validation of a Quantitative Assay for ST-246 in Human Plasma

In this work, we developed and validated a robust and sensitive method of liquid chromatography with high-resolution mass spectrometry in parallel reaction monitoring (PRM) mode for ST-246 (tecovirimat) quantification in human blood plasma. The method was compared with the multiple reaction monitoring (MRM) technique and showed better selectivity and similar sensitivity in a wider concentration range (10–5000 ng/mL). Within this range, intra- and interday variability of precision and accuracy were within acceptable ranges in accordance with the European Medicines Agency guidelines, and recovery was 87.9–100.6%. Samples were stable at 4 °C within 48 h and at −20 °C up to 3 months. The recovery and matrix effects in the proposed HRMS method were about 5% higher than those reported for the MRM method, but the PRM method showed better accuracy with comparable precision. It was found that the ST-246 concentration shown by the PRM method is approximately 24% higher than the output of the MRM one. Nonetheless, the high selectivity with similar sensitivity, as compared with traditional MRM methods, makes the proposed approach attractive for research and clinical use

Thermodynamic Swings: How Ideal Complex of Cas9–RNA/DNA Forms

Most processes of the recognition and formation of specific complexes in living systems begin with collisions in solutions or quasi-solutions. Then, the thermodynamic regulation of complex formation and fine tuning of complexes come into play. Precise regulation is very important in all cellular processes, including genome editing using the CRISPR–Cas9 tool. The Cas9 endonuclease is an essential component of the CRISPR–Cas-based genome editing systems. The attainment of high-specificity and -efficiency Cas9 during targeted DNA cleavage is the main problem that limits the practical application of the CRISPR–Cas9 system. In this study, we analyzed the thermodynamics of interaction of a complex’s components of Cas9–RNA/DNA through experimental and computer simulation methods. We found that there is a small energetic preference during Cas9–RNA/DNA formation from the Cas9–RNA and DNA/DNA duplex. The small difference in binding energy is relevant for biological interactions and could be part of the sequence-specific recognition of double-stranded DNA by the CRISPR–Cas9 system

Non-Targeted Screening of Metabolites in Aqueous-Ethanol Extract from <i>Spiraea hypericifolia</i> (Rosaceae) Using LC-HRMS

By means of liquid chromatography combined with high-resolution mass spectrometry, metabolite profiling was performed on an aqueous-ethanol extract from Spiraea hypericifolia (Rosaceae) collected in Siberia (Russia). Up to 140 compounds were found in the extract, of which 47 were tentatively identified. The identified compounds were amino acids, sugars, phenylpropanoids, fatty acids and their derivatives, triterpenoids, flavonoids, and others. A quantitative analysis showed the predominance of phenolcarboxylic acids and flavonoids in the studied extract, but a qualitative analysis revealed the higher structural diversity of flavonoids. Of the 23 identified flavonoids, 13 were flavonols: quercetin, hyperoside, isoquercitrin, reynoutrin, avicularin, rutin, quercetin-3-O-(6″-O-malonyl)-β-D-glucoside, 3-O-methylquercetin-3′-O-β-D-glucopyranoside, isorhamnetin, rhamnetin-3-O-β-D-xylopyranosyl-β-D-glucopyranoside, kaempferol, tiliroside, and trifolin; six were catechins: catechin, (−)-epicatechin, (+)-epicatechin, (+)-catechin-7-O-β-D-xyloside, (2S,3R)-3,5-dihydroxy-2-(4-hydroxyphenyl)-3,4-dihydro-2H-chromen-7-yl-β-D-glucopyranoside, and catechin 7-O-apiofuranoside; two are isoflavones: genistin and genistein; and one was a flavone (luteolin-4′-O-β-D-glucopyranoside) and another was an anthocyanidin (pelargonidin). The aqueous-ethanol extract from S. hypericifolia showed antioxidant activity (half-maximal inhibitory concentration 102.95 μg/mL), which was likely related to the high concentrations of phenolcarboxylic acids (229.6 mg/g), flavonoids (118.3 mg/g), and tannins (62.9 mg/g)

Development and Validation of a Method of Liquid Chromatography Coupled with Tandem Mass Spectrometry for Quantification of ST-246 (Tecovirimat) in Human Plasma

The aim of this work was to develop and validate a sensitive and robust method of liquid chromatography coupled with tandem mass spectrometry to quantitate ST-246 (tecovirimat) in plasma using an internal standard (2-hydroxy-N-{3,5-dioxo-4-azatetracyclo [5.3.2.02.6.08.10]dodec-11-en-4-yl}-5-methylbenzamide). The method was validated in negative multiple reaction monitoring mode following recommendations of the European Medicines Agency for the validation of bioanalytical methods. The calibration curve for the analyte was linear in the 10&ndash;2500 ng/mL range with determination coefficient R2 &gt; 0.99. Intra- and inter-day accuracy and precision for three concentrations of quality control were &lt;15%. Testing of long-term stability of ST-246 (tecovirimat) in plasma showed no degradation at &minus;20 &deg;C for at least 3 months. The method was applied to a clinical assay of a new antipoxvirus compound, NIOCH-14. Thus, the proposed method is suitable for therapeutic drug monitoring of ST-246 (tecovirimat) itself and of NIOCH-14 as its metabolic precursor