Efficient Text-Guided 3D-Aware Portrait Generation with Score Distillation Sampling on Distribution

Text-to-3D is an emerging task that allows users to create 3D content with infinite possibilities. Existing works tackle the problem by optimizing a 3D representation with guidance from pre-trained diffusion models. An apparent drawback is that they need to optimize from scratch for each prompt, which is computationally expensive and often yields poor visual fidelity. In this paper, we propose DreamPortrait, which aims to generate text-guided 3D-aware portraits in a single-forward pass for efficiency. To achieve this, we extend Score Distillation Sampling from datapoint to distribution formulation, which injects semantic prior into a 3D distribution. However, the direct extension will lead to the mode collapse problem since the objective only pursues semantic alignment. Hence, we propose to optimize a distribution with hierarchical condition adapters and GAN loss regularization. For better 3D modeling, we further design a 3D-aware gated cross-attention mechanism to explicitly let the model perceive the correspondence between the text and the 3D-aware space. These elaborated designs enable our model to generate portraits with robust multi-view semantic consistency, eliminating the need for optimization-based methods. Extensive experiments demonstrate our model's highly competitive performance and significant speed boost against existing methods

Alteration of CXCR7 Expression Mediated by TLR4 Promotes Tumor Cell Proliferation and Migration in Human Colorectal Carcinoma

The link between inflammation and colorectal carcinoma has been acknowledged. However, the impact of bacterial lipopolysaccharide (LPS) binding to Toll-like receptor 4 (TLR4) on chemokine receptors in human colorectal carcinoma cells still remains to be elucidated. The present study shows that exposure to LPS elevated CXC chemokine receptor 7 (CXCR7) expression in colorectal carcinoma SW480 and Colo 205 cell lines expressing TLR4/myeloid differential protein (MD-2). CXCR7 is associated with SW480 cell proliferation and migration. However, exposure of SW480 and Colo 205 cells to LPS had no effect on CXCR4 expression. To further support the above results, the expression of TLR4, MD-2, and CXCR7 was analyzed in human colorectal carcinoma tissues. Higher rates of TLR4 (53%), MD-2 (70%), and CXCR7 (29%) expression were found in colorectal carcinoma tissues than in normal tissues. We demonstrated that the recombination of TLR4, MD-2 and CXCR7 strongly correlated with tumor size, lymph node metastasis and distant metastasis in colorectal carcinoma tissue samples (p = 0.037, p = 0.002, p = 0.042, resp.). Accordingly, simultaneous examination of the expression of TLR4, MD-2 and CXCR7 in cancer tissues of colorectal carcinoma may provide valuable prognostic diagnosis of carcinoma growth and metastasis. Interplay of TLR4, MD-2 and CXCR7 may be of interest in the context of novel immunomodulatory therapies for colorectal carcinoma

A pivotal role of BEX1 in liver progenitor cell expansion in mice

Abstract Background The activation and expansion of bipotent liver progenitor cells (LPCs) are indispensable for liver regeneration after severe or chronic liver injury. However, the underlying molecular mechanisms regulating LPCs and LPC-mediated liver regeneration remain elusive. Methods Hepatic brain-expressed X-linked 1 (BEX1) expression was evaluated using microarray screening, real-time polymerase chain reaction, immunoblotting and immunofluorescence. LPC activation and liver injury were studied following a choline-deficient, ethionine-supplemented (CDE) diet in wild-type (WT) and Bex1 −/− mice. Proliferation, apoptosis, colony formation and hepatic differentiation were examined in LPCs from WT and Bex1 −/− mice. Peroxisome proliferator-activated receptor gamma was detected in Bex1-deficient LPCs and mouse livers, and was silenced to analyse the expansion of LPCs from WT and Bex1 −/− mice. Results Hepatic BEX1 expression was increased during CDE diet-induced liver injury and was highly elevated primarily in LPCs. Bex1 −/− mice fed a CDE diet displayed impaired LPC expansion and liver regeneration. Bex1 deficiency inhibited LPC proliferation and enhanced LPC apoptosis in vitro. Additionally, Bex1 deficiency inhibited the colony formation of LPCs but had no effect on their hepatic differentiation. Mechanistically, BEX1 inhibited peroxisome proliferator-activated receptor gamma to promote LPC expansion. Conclusion Our findings indicate that BEX1 plays a pivotal role in LPC activation and expansion during liver regeneration, potentially providing novel targets for liver regeneration and chronic liver disease therapies

Autophagy is Required for the Maintenance of Liver Progenitor Cell Functionality

Background: Liver progenitor cells (LPCs) are bipotent stem cells existing in the adult liver, which could be activated upon massive liver injury and contribute to liver regeneration. However, mechanisms of maintenance of LPC functionality remain poorly understood. Previous studies found that autophagy was required for the self-renewal and differentiation of several tissue stem cells. Methods: The study compared the level of autophagic activity in LPCs and differentiated hepatocytes. Then, autophagic activity was inhibited in LPCs by lentivirus-mediated autophagy-related gene 5 or Beclin 1 knockdown. Clonogenic assay, cell viability assays, hepatic differentiation assay, and senescence analysis were conducted to assess the role of autophagy in regulating self-renewal, hepatic differentiation and senescence of LPCs. Results: We observed high autophagic activity in LPCs compared with differentiated hepatocytes. We found that inhibition of autophagy impaired the self-renewal, proliferation, and hepatic differentiation capability of LPCs under normal cultural condition, but had little impact on cell viability. Interestingly, while wild-type LPCs remained rarely affected by the toxin, etoposide, inhibition of autophagy induced the senescent phenotype of LPCs. Overexpression of Beclin 1 in Beclin 1-knockdown LPCs restored the functionality of stem cells. Conclusion: Our findings indicate that autophagy may function as a critical regulator of LPC functionality under both physiological and pathological condition

Distinct roles of Dlk1 isoforms in bi-potential differentiation of hepatic stem cells

Abstract Background Fully understanding the developmental process of hepatic stem cells (HSCs) and the mechanisms of their committed differentiation is essential for optimizing the generation of functional hepatocytes for cell therapy in liver disease. Delta-like 1 homolog (Dlk1), primarily the membrane-bound form (Dlk1M), is generally used as a surface marker for fetal hepatic stem cell isolation, while its soluble form (Dlk1S) and the functional roles of different Dlk1 isoforms in HSC differentiation remain to be investigated. Methods Hepatic spheroid-derived cells (HSDCs) were isolated from E12.5 mouse livers to obtain Dlk1+ and Dlk1−subpopulations. Colony formation, BrdU staining, and CCK8 assays were used to evaluate the cell proliferation capacity, and hepatic/cholangiocytic differentiation and osteogenesis/adipogenesis were used to assess the multipotency of the two subpopulations. Transformation of Dlk1+ cells into Dlk1− cells was detected by FACS, and the expression of Dlk1 isoforms were measured by western blot. The distinct roles and regulatory mechanisms of Dlk1 isoforms in HSC differentiation were investigated by overexpressing Dlk1M. Results HSDCs were capable of differentiating into liver and mesenchymal lineages, comprising Dlk1+ and Dlk1− subpopulations. Dlk1+ cells expressed both Dlk1M and Dlk1S and lost expression of Dlk1M during passaging, thus transforming into Dlk1− cells, which still contained Dlk1S. Dlk1− cells maintained a self-renewal ability similar to that of Dlk1+ cells, but their capacity to differentiate into cholangiocytes was obviously enhanced. Forced expression of Dlk1M in Dlk1− cells restored their ability to differentiate into hepatocytes, with an attenuated ability to differentiate into cholangiocytes, suggesting a functional role of Dlk1 in regulating HSC differentiation in addition to acting as a biomarker. Further experiments illustrated that the regulation of committed HSC differentiation by Dlk1 was mediated by the AKT and MAPK signaling pathways. In addition, bFGF was found to serve as an important inducement for the loss of Dlk1M from Dlk1+ cells, and autophagy might be involved. Conclusions Overall, our study uncovered the differential expression and regulatory roles of Dlk1 isoforms in the commitment of HSC differentiation and suggested that Dlk1 functions as a key regulator that instructs cell differentiation rather than only as a marker of HSCs. Thus, our findings expand the current understanding of the differential regulation of bi-potential HSC differentiation and provide a fine-tuning target for cell therapy in liver disease

Additional file 1: of A pivotal role of BEX1 in liver progenitor cell expansion in mice

Figure S1. Genetic ablation of Bex1 in mice. Genomic DNA was isolated, and genotyping of Bex1 performed using PCR. Primers as follows: Bex1–3′, TTCATTTCCCCATCTGAAAGGTCCG; Bex1–5′, TCCCACCTACTCACCCATCCTTCTGG; LTR-5′, AAATGGCGTTACTTAAGCTAGCTTGC. Product size for WT mice is 352 bp, and for Bex1−/− mice is 223 bp (PDF 47 kb

The simple and multiple logistic regression model analyzing the predictors of colorectal carcinoma lymph node metastasis.

<p>*ORs and 95% CIs were calculated by unconditional logistic regression after adjusting for age, sex, tumor size and histologic grade.</p