Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to resistance; and strengthen the case for a role in survival of systems involved in manganese and iron homeostasis

Worldwide comparison of survival from childhood leukaemia for 1995–2009, by subtype, age, and sex (CONCORD-2): a population-based study of individual data for 89 828 children from 198 registries in 53 countries

Background Global inequalities in access to health care are reflected in differences in cancer survival. The CONCORD programme was designed to assess worldwide differences and trends in population-based cancer survival. In this population-based study, we aimed to estimate survival inequalities globally for several subtypes of childhood leukaemia. Methods Cancer registries participating in CONCORD were asked to submit tumour registrations for all children aged 0-14 years who were diagnosed with leukaemia between Jan 1, 1995, and Dec 31, 2009, and followed up until Dec 31, 2009. Haematological malignancies were defined by morphology codes in the International Classification of Diseases for Oncology, third revision. We excluded data from registries from which the data were judged to be less reliable, or included only lymphomas, and data from countries in which data for fewer than ten children were available for analysis. We also excluded records because of a missing date of birth, diagnosis, or last known vital status. We estimated 5-year net survival (ie, the probability of surviving at least 5 years after diagnosis, after controlling for deaths from other causes [background mortality]) for children by calendar period of diagnosis (1995-99, 2000-04, and 2005-09), sex, and age at diagnosis (< 1, 1-4, 5-9, and 10-14 years, inclusive) using appropriate life tables. We estimated age-standardised net survival for international comparison of survival trends for precursor-cell acute lymphoblastic leukaemia (ALL) and acute myeloid leukaemia (AML). Findings We analysed data from 89 828 children from 198 registries in 53 countries. During 1995-99, 5-year agestandardised net survival for all lymphoid leukaemias combined ranged from 10.6% (95% CI 3.1-18.2) in the Chinese registries to 86.8% (81.6-92.0) in Austria. International differences in 5-year survival for childhood leukaemia were still large as recently as 2005-09, when age-standardised survival for lymphoid leukaemias ranged from 52.4% (95% CI 42.8-61.9) in Cali, Colombia, to 91.6% (89.5-93.6) in the German registries, and for AML ranged from 33.3% (18.9-47.7) in Bulgaria to 78.2% (72.0-84.3) in German registries. Survival from precursor-cell ALL was very close to that of all lymphoid leukaemias combined, with similar variation. In most countries, survival from AML improved more than survival from ALL between 2000-04 and 2005-09. Survival for each type of leukaemia varied markedly with age: survival was highest for children aged 1-4 and 5-9 years, and lowest for infants (younger than 1 year). There was no systematic difference in survival between boys and girls. Interpretation Global inequalities in survival from childhood leukaemia have narrowed with time but remain very wide for both ALL and AML. These results provide useful information for health policy makers on the effectiveness of health-care systems and for cancer policy makers to reduce inequalities in childhood survival

Inter-domain crosstalk in the phytochrome molecules

Phytochromes are bifunctional photoreceptors with a two-domain structure, consisting of the N-terminal photosensory domain and the C-terminal regulatory domain. The photo-induced Pr Pfr phototransformation accompanies subtle conformational changes, primarily triggered by the apoprotein-chromophore interactions in the N-terminal domain. The conformational signals are subsequently transmitted to the C-terminal domain through various inter-domain crosstalks, resulting in the interaction of the activated C-terminal domain with phytochrome interacting factors. Thus the inter-domain crosstalks play critical roles in the photoactivation of the phytochromes. Protein phosphorylation, such as that of Ser-598, is implicated in this process by inducing conformational changes and by modulating infer-domain signaling

Molecular cloning and expression analysis of the cell-wall invertase gene family in rice (Oryza sativa L.)

Cell-wall invertase (CIN) catalyzes the hydrolysis of sucrose into glucose and fructose for the supply of carbohydrates to sink organs via an apoplastic pathway. To study the CIN genes in rice (Oryza sativa L.), we isolated cDNA clones showing amino acid similarity to the plant cell wall invertase proteins from a search of rice sequence databases. Profile analyses revealed that the cloned genes are expressed in unique patterns in various organs. For example, transcripts of OsCIN1, OsCIN2, OsCIN4, and OsCIN7 were detected in immature seeds whereas OsCIN3 gene expression was flower-specific. Further transcript analysis of these genes expressed in developing seeds indicated that OsCIN1, OsCIN2, and OsCIN7 might play an important role involving sucrose partitioning to the embryo and endosperm. Sucrose, a substrate of CINs, induced the accumulation of OsCIN1 transcripts in excised leaves and OsCIN2 in immature seeds, while the level of OsCIN5 was significantly down-regulated in excised leaves treated with sucrose. Infecting the tissues with rice blast (Magnaporthe grisea) as a biotic stressor increased the expression of OsCIN1, OsCIN4, and OsCIN5, suggesting that these genes may participate in a switch in metabolism to resist pathogen invasion. These results demonstrate that OsCIN genes play diverse roles involving the regulation of metabolism, growth, development, and stress responses.X1154sciescopu

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate : fructose-6-phosphate 1-phosphotransferase alpha 2 gene that is essential for expression

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFP alpha genes were analyzed using transgenic plants containing a promoter::beta-glucuronidase (GUS) fusion construct. Whereas the AtPFP alpha 1 promoter was found to be ubiquitously active in all tissues, the AtPFP alpha 2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFP alpha 2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFP alpha 2 and which is essential for AtPFP alpha 2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFP alpha 2 is sufficient for normal AtPFP alpha 2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFP alpha 2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.X115sciescopu

Knockout of a starch synthase gene OsSSIIIa/Flo5 causes white-core floury endosperm in rice (Oryza sativa L.)

To elucidate the role of SSIIIa during starch synthesis in rice (Oryza sativa L.) endosperm, we characterized null mutants of this gene, generated by T-DNA insertions. Scanning electron microscope (SEM) analysis revealed that the starch granules in these mutants are smaller and rounder compared with the wild type controls, and that the mutant endosperm is characterized by a loosely packed central portion exhibiting a floury-like phenotype. Hence, the OsSSIIIa (Oryza sativa SSIIIa) mutations are referred to as white-core floury endosperm 5-1 (flo5-1) and flo5-2. Based upon their X-ray diffraction patterns, the crystallinity of the starch in the flo5 mutant endosperm is decreased compared with wild type. Through determination of the chain-length distribution of the mutant endosperm starch, we found that flo5-1 and flo5-2 mutants have reduced the content of long chains with degree of polymerization (DP) 30 or greater compared with the controls. This suggests that OsSSIIIa/Flo5 plays an important role in generating relatively long chains in rice endosperm. In addition, DP 6 to 8 and DP 16 to 20 appeared to be reduced in endosperm starch of flo5-1 and flo5-2, whereas DP 9 to 15 and DP 22 to 29 were increased in these mutants. By the use of differential scanning calorimetry (DSC), the gelatinization temperatures of endosperm starch were found to be 1-5 degrees C lower than those of the control. We propose a distinct role for OsSSIIIa/Flo5 and the coordinated action of other SS isoforms during starch synthesis in the seed endosperm of rice.X116262sciescopu

Structure, expression, and functional analysis of the hexokinase gene family in rice (Oryza sativa L.)

Hexokinase (HXK) is a dual-function enzyme that both phosphorylates hexose to form hexose 6-phosphate and plays an important role in sugar sensing and signaling. To investigate the roles of hexokinases in rice growth and development, we analyzed rice sequence databases and isolated ten rice hexokinase cDNAs, OsHXK1 (Oryza sativa Hexokinase 1) through OsHXK10. With the exception of the single-exon gene OsHXK1, the OsHXKs all have a highly conserved genomic structure consisting of nine exons and eight introns. Gene expression profiling revealed that OsHXK2 through OsHXK9 are expressed ubiquitously in various organs, whereas OsHXK10 expression is pollen-specific. Sugars induced the expression of three OsHXKs, OsHXK2, OsHXK5, and OsHXK6, in excised leaves, while suppressing OsHXK7 expression in excised leaves and immature seeds. The hexokinase activity of the OsHXKs was confirmed by functional complementation of the hexokinase-deficient yeast strain YSH7.4-3C (hxk1, hxk2, glk1). OsHXK4 was able to complement this mutant only after the chloroplast-transit peptide was removed. The subcellular localization of OsHXK4 and OsHXK7, observed with green fluorescent protein (GFP) fusion constructs, indicated that OsHXK4 is a plastid-stroma-targeted hexokinase while OsHXK7 localizes to the cytosol.X1166sciescopu

Identification of the ADP-glucose pyrophosphorylase isoforms essential for starch synthesis in the leaf and seed endosperm of rice (Oryza sativa L.)

ADP-glucose pyrophosphorylase (AGP) catalyzes the first committed step of starch biosynthesis in higher plants. To identify AGP isoforms essential for this biosynthetic process in sink and source tissues of rice plants, we analyzed the rice AGP gene family which consists of two genes, OsAGPS1 and OsAGPS2, encoding small subunits (SSU) and four genes, OsAGPL1, OsAGPL2, OsAGPL3 and OsAGPL4, encoding large subunits (LSU) of this enzyme heterotetrameric complex. Subcellular localization studies using green fluorescent protein (GFP) fusion constructs indicate that OsAGPS2a, the product of the leaf-preferential transcript of OsAGPS2, and OsAGPS1, OsAGPL1, OsAGPL3, and OsAGPL4 are plastid-targeted isoforms. In contrast, two isoforms, SSU OsAGPS2b which is a product of a seed-specific transcript of OsAGPS2, and LSU OsAGPL2, are localized in the cytosol. Analysis of osagps2 and osagpl2 mutants revealed that a lesion of one of the two cytosolic isoforms, OsAGPL2 and OsAGPS2b, causes a shrunken endosperm due to a remarkable reduction in starch synthesis. In leaves, however, only the osagps2 mutant appears to severely reduce the transitory starch content. Interestingly, the osagps2 mutant was indistinguishable from wild type during vegetative plant growth. Western blot analysis of the osagp mutants and wild type plants demonstrated that OsAGPS2a is an SSU isoform mainly present in leaves, and that OsAGPS2b and OsAGPL2 are the major SSU and LSU isoforms, respectively, in the endosperm. Finally, we propose a spatiotemporal complex model of OsAGP SSU and LSU isoforms in leaves and in developing endosperm of rice plants.X1181sciescopu

Loss of cytosolic fructose-1,6-bisphosphatase limits photosynthetic sucrose synthesis and causes severe growth retardations in rice (Oryza sativa)

During photosynthesis, triose-phosphates (trioseP) exported from the chloroplast to the cytosol are converted to sucrose via cytosolic fructose-1,6-bisphosphatase (cFBPase). Expression analysis in rice suggests that OscFBP1 plays a major role in the cytosolic conversion of trioseP to sucrose in leaves during the day. The isolated OscFBP1 mutants exhibited markedly decreased photosynthetic rates and severe growth retardation with reduced chlorophyll content, which results in plant death. Analysis of primary carbon metabolites revealed both significantly reduced levels of sucrose, glucose, fructose and starch in leaves of these mutants, and a high accumulation of sucrose to starch in leaves of rice plants. In the oscfbp1 mutants, products of glycolysis and the TCA cycle were significantly increased. A partitioning experiment of C-14-labelled photoassimilates revealed altered carbon distributions including a slight increase in the insoluble fraction representing transitory starch, a significant decrease in the neutral fraction corresponding to soluble sugars and a high accumulation of phosphorylated intermediates and carboxylic acid fractions in the oscfbp1 mutants. These results indicate that the impaired synthesis of sucrose in rice cannot be sufficiently compensated for by the transitory starch-mediated pathways that have been found to facilitate plant growth in the equivalent Arabidopsis mutants.X1136sciescopu