Responses of commonly cultivated tomato cultivars in Nepal to bacterial speck

Ten predominantly cultivated cultivars of tomato (Solanum lycopersicum L.) in Nepal were tested in the plastic tunnel and in the field for their susceptibility to Pseudomonas syringae pv.  tomato, the causal agent of bacterial speck. Each cultivar was artificially inoculated with P. s. pv. tomato, by means of a leaf spray method both in the tunnel and in the field. Among the tested cultivars four out of ten were local cultivars and the remaining cultivars were hybrids. The genotypes exhibited a large amount of variation in response to the bacterial infection, with disease severity index (DSI) ratings from 1.80 to 4.25 in the field and from 1.10 to 4.20 in the tunnel. The cultivars Thims 16, C.L. and Spectra 737 were the less susceptible in the field, with DSI values of 1.80, 2.05 and 2.25, respectively; while in the tunnel all the local cultivars (C.L., Panjabi, B.L. and Lapsi Gede) showed a very low level of susceptibility, with respective DSI values of 1.10, 1.20, 1.65 and 2.30. In the field, the most susceptible was the cultivar Lapsi Gede (DSI=4.25) and in the tunnel it was represented by the cultivar NS-719 (DSI= 4.20)

Bacterial leaf spot caused by Xanthomonas cucurbitae newly reported on pumpkin in Nepal

Xanthomonascucurbitae causes leaf spots of cucurbits worldwide (Bradbury, 1986; Maringoni & Leite, 1988). During a survey made in 2009, small necrotic spots with chlorotic haloes were observed on the leaf surface and also scab-like lesions on fruits of pumpkin plants (Cucurbita moschatavar. Arka Chandan). Symptoms were observed in several commercial vegetable fields at Thimi and Bashundhara areas, in Bhaktapur and Kathmandu districts respectively, Central Region, Nepal. Samples were collected from both fields, and yellow-pigmented Xanthomonas-like bacterial colonies were observed on yeast peptone glucose agarafter streaking and incubation at 28 ± 1°C for 48 hours. Six isolates were identified as Xanthomonas cucurbitae on the basis of morphological, physiological and biochemical tests. All strains were Gram negative rods, aesculin positive, produced H2S from peptone and grew at 36°C. All the strains produced acid from arabinose, galactose and trehalose.Pathogenicity of the isolates was confirmed on pumpkin plants (cvs. Arka Chandan and Lunga di Napoli) in greenhouse tests by spraying 10 healthy potted plants of each cultivar with bacterial suspensions (108cfu/ ml) of each isolate. A known Xanthomonas cucurbitaestrain (CFBP 922) and sterile distilled water were used, respectively, as positive and negative controls. All the strains caused symptoms similar to those observed in the field within a week of artificial inoculation. Bacteria re-isolated from the lesions were similar to the original strains according to the above-mentioned morphological, cultural and biochemical tests. A 1473 bp region of the 16S rDNA from all strains was amplified with primers NOC-1F (5'AGAGTTTGATCATGGCTCAG3') and NOC-3R (3'ACGGTTACCTTGTTACGACTT5') and sequenced (GenBank Accession No. GU373651, strain NEP XC10). A BlastN search of GenBank revealed that the strains had 100% identity with the 16S rDNA sequence of Xanthomonas cucurbitae type strainLMG 690 (NR_026387). The finding of this pathogen in Nepal is particularly significant since cucurbits represent one of the major vegetable crops of Nepal .This pathogen has been reported both in India and China (Bradbury, 1986) with which Nepal shares its boundaries. Contaminated seeds and/or transplants may have been the source of introduction of the pathogen to this region. To our knowledge, this is first report of Xanthomonas cucurbitae on pumpkin in Nepal

First Report of bacterial spot caused by Xanthomonas campestris pv. vesicatoria race 2 in Nepal

Tomato is one of the most important vegetable crops in Nepal. Duringthe spring of 2009, dark, circular and water -soaked lesions of about 3 mm in diameter were observed on leaves of tomato plants (Solanum lycopersicum ) cv. Pusa Ruby), in three different commercial farms at Indrapur, Banke district, Mid-western region. Disease incidence was estimated to be in the range 50-60%. Yellow-pigmented bacterial colonies were consistently isolated from diseased tissues on yeast extract-dextrose-calcium carbonate agar medium (YDC) and incubated at 26 ± 1°C. Six isolates were identified as Xanthomonas campestris pv. vesicatoria on the basis of morphological and biochemical tests. All the isolates were Gram-negative, rod shaped, motile, aerobic, oxidase negative, catalase positive and amylolytic positive. All six isolates grew on Tween medium (Mcguire et al., 1986). Pathogenicity was confirmed on tomato plants (cv. Pool Rex Bio) in a greenhouse by spraying four healthy potted plants for each isolate with a bacterial suspension (108cfu/ml). A known strain and sterile distilled water were used respectively as positive and negative controls. All strains caused symptoms similar to those o bserved in the field within a week of inoculation. The race of the pathogen was distinguished by another pathogenicity test on cvs. Hawai 7998, Hawai 7981 and John Baer. The first two are resistant respectively to races 1 and 3 and all of them are susceptible to race 2 of the pathogen (De Souza et al., 2008).The bacterial isolate caused symptoms on all three cultivars, confirming that it belongs to race 2. Bacteria re-isolated from the necrotic lesions were shown to be identical to the original strains according to the morphological, cultural and biochemical tests described above. Molecular identification was achieved by sequencing the 16S rDNA region (GenBank Accession No. GU075707, strain NEP XCV09). The sequence shared 99% identity with the analogous sequence of X. campestris pv. vesicatoria (syn. X. vesicatoria; Jones et al., 2004) type strain (AY288080). This pathogen has already been reported from China (Jilin, Xinjiang) and India (Andhra Pradesh, Delhi). Contaminated seeds and/or transplants may have been the source of introduction of this pathogen to this region of Nepal from neighbouring areas of India. To the best of our knowledge, this is the first report of bacterial spot on tomato plants in Nepal

Responses of tomato cultivars largely cultivated in Nepal to Pseudomonas syringae pv. tomato

Ten commonly cultivated cultivars of tomato (Solanum lycopersicum L.) in Nepal were tested in a plastic tunnel and in the field for their susceptibility to Pseudomonas syringae pv. tomato, the causal agent of bacterial speck. Four of the ten cultivars were local and six were hybrids. The leaves of each cultivar were sprayed with P. s. pv. tomato both in the tunnel and in the field. The genotypes exhibited a considerable variation in response to infection, with the disease severity index (DSI) varying from 1.80 to 4.25 in the field and from 1.10 to 4.20 in the tunnel. The cultivars Thims 16, C.L. and Spectra 737 were the least susceptible in the field, with DSI values of 1.80, 2.05 and 2.25, respectively; while in the tunnel all the local cultivars (C.L., Panjabi, B.L. and Lapsi Gede) showed very low susceptibility, with respective DSI values of 1.10, 1.20, 1.65 and 2.30. In the field, the most susceptible cultivar was Lapsi Gede (DSI=4.25) and in the tunnel the most susceptible was NS719 (DSI= 4.20)

Reproductive indices in natural nests of giant Amazon river turtles Podocnemis expansa (Schweigger, 1812) (Testudines, Podocnemididae) in the Environmental Protection Area Meanders of the Araguaia river

A count was made of unhatched eggs and hatchling live and dead Podocnemis expansa turtles in 327 natural nests located on the beaches of the Environmental Protection Area (EPA) Meanders of the Araguaia River, to determine the percentage of hatching (94.63%), non-hatching (5.37%), survival (94.24%) and hatchling mortality (5.76%), and the average percentage of dead hatchlings during the 15 days in the nursery (0.97%). The mean number of hatchlings per nest was determined from the sum of the number of live and dead hatchlings divided by the total number of nests, while the mean number of eggs per nest was determined from the sum of live and dead hatchlings and unhatched eggs divided by the number of nests. These calculations yielded the following mean values: live hatchlings (88.98 ± 23.94), dead hatchlings (0.37 ± 0.93), unhatched eggs (5.07 ± 9.57), and total number of eggs (94.42 ± 21.30). The reproductive efficiency of the wild population of P. expansa can be affected by many environmental factors such as temperature, humidity and rainfall. In addition, man-made factors like the presence of chemicals in the water and the potential for infectious disease also have significant impact. The reproductive indices data obtained from this study are indispensable for future investigations of hatching anomalies