64 research outputs found
Comparison between Cloprostenol-induced and Spontaneous Oestrus Fertility in Dairy Cows
A short calving to conception interval is of main importance to achieve high economic efficiency in dairy cow industry. In order to reduce this interval, several hormonal treatments have been put on the market, in which cloprostenol, a synthetic analogue of prostaglandin F2 (PGF2). The aim of this study was to compare fertility of cloprostenol-induced oestrus to that of spontaneous oestrus in dairy cows. In a group of 525 cows, 280 (treated group) were administered 0.5 mg cloprostenol i.m. after transrectal corpus luteum (CL) detection, and inseminated at detected oestrus during the following week. The other 245 cows (control group) were inseminated during spontaneous oestrus. Whey progesterone concentrations were checked at treatment and at insemination in order to remove from the study cows whose P4 levels indicate a non-functional CL, or a lack of luteolysis respectively. Moreover, cows that were not inseminated due to genital problems were also excluded from this study. Conception (59% vs 54.5%) and calving rates (93.7% vs 93%) were not significantly different between the two groups
Conversion of t11t13 CLA into c9t11 CLA in Caco-2 Cells and Inhibition by Sterculic Oil
Background : Conjugated linoleic acids (CLA), and principally c9t11 CLA, are suspected to have numerous preventive properties regarding non-infectious pathologies such as inflammatory diseases, atherosclerosis and several types of cancer. C9t11 CLA is produced in the rumen during biohydrogenation of linoleic acid, but can also be synthesized in mammalian tissues from trans-vaccenic acid (C18:1 t11) through the action of delta-9 desaturase (D9D). For several years, it is also known that c9t11 CLA can be synthesized from conjugated linolenic acids (CLnA), i.e. c9t11c13 CLnA and c9t11t13 CLnA. This study aimed at investigating to which extent and by which route c9t11 CLA can be produced from another isomer of CLA, the t11t13 CLA that is structurally very similar to c9t11t13 CLnA, in Caco-2 cells
Delta6-desaturase insertion/deletion polymorphism impact on muscle fatty acid profile in Adriatic grayling (Thymallus thymallus)
Nutritionists recommend the consumption of fish for its beneficiai properties due to the high content in long chain omega-J fatty acids (LC-PUFA), namely DHA and EPA. As fish fatty acid composition is largely inf1uenced by the diet, irrespective of species, increased synthesis of LC- PUFA is not able to compensate for the lack of dietary n-3 LC PUFA. LC-PUFA synthesis from 18:3n-3 has been shown to be increased in fish fed diets with fish oil
substituted by vegetable oils through up regulation of desatura se and elongase gene expression and increased activity of the desaturationlelongation pathway has been documented in freshwater species. Fatty acid desaturase 2 (FADS2) or t>-6 desaturase is the
rate limiting enzyme in the production of EPA and DHA from a-linolenic acid and is therefore a candidate gene for EPA and DHA synthesis in fish fillet.
This research was aimed to study the t>6-desaturase polymorphism and its impact on muscle fatty acid profile of a freshwater fish species, the Adriatic grayling (Thymallus thymallus), chosen as fish mode!.
delta6-desaturase polymorphism has been studied by using several primers for the PCR. Twenty seven specimens of Adriatic grayling, kept under controlled rearing conditions at the facilities of Udine University, were genotyped by PCR (forward primer: AAAGAAGTTGAAGTACATGCCCTA, reverse primer: AGTTCCGTTGTGAAAACATGG) and fatty acid content of fillet intramuscular fat were deterrnined by gas chromatography analysis . Single locus genotype assoc iation analyses, using the Generai Linear Mixed Model in SPSS, were carried out.
Through sequencing, an insertionldeletion polymorphism was observed in the seventh intron of FADS2 and the insertion consists in 8 repeats of CTGT (32 bp). An almost significant association was found between FADS2 polymorphism and the ratio ofC18:4 n-3 to CI8:3 n-3 (P =0.088) which is the first step in the desaturation pathway. In conclusion, these preliminary results suggest that the genetic selection of Adriatic grayling with this mutation might improve its ability to utilise dietary LC-PUFA precursors and so practical diets strongly deprived of preforrned LC PUFA. It is possible to hypothesise an improvement in the utilization of vegetable meal and oil in other finfish species of aquaculture interest
- …