Seroprevalence of SARS-CoV-2 IgG among healthcare workers in Lagos, Nigeria.

Healthcare workers (HCWs) are disproportionately infected with SARS-CoV-2 when compared to members of the general public; estimating the seroprevalence of SARS-CoV-2 antibody and SARS-CoV-2 infection rate among HCWs is therefore crucial. This study was carried out in four health facilities in Lagos Nigeria to determine the prevalence of IgG antibodies (seroprevalence) and SARS-CoV-2 active infection rate via a positive rtPCR result, the cross-sectional study was conducted between December 2020 and July 2021. Nasopharyngeal and blood samples were collected from HCWs and screened for SARS-CoV-2 infection using the rtPCR technique and antibody using the Abbott anti-SARS-CoV-2 IgG CMIA assay, respectively. Demographic and occupational exposures data were obtained and analysed using descriptive and inferential statistics, variables significant via inferential statistics were subjected to a multivariate analysis. A total of 413 participants were enrolled, with a mean age in years of 38.4±11.0. The seroprevalence was 30.9% (115/372) while 63/395 (15.9%) were actively infected with the virus. HCWs whose job role had direct contact with patients had a higher percentage of SARS-CoV-2 infection when compared with those not in direct contact, also being a health care worker was significantly associated with getting a positive COVID-19 PCR result. In conclusion the SARS-CoV-2 seroprevalence seen in this study was higher than national serosurvey estimates indicating HCWs are at higher risk of COVID-19 infection when compared to the general public. Vaccination and effective implementation of infection control measures are important to protect HCWs

The evolving SARS-CoV-2 epidemic in Africa: Insights from rapidly expanding genomic surveillance.

Investment in severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) sequencing in Africa over the past year has led to a major increase in the number of sequences that have been generated and used to track the pandemic on the continent, a number that now exceeds 100,000 genomes. Our results show an increase in the number of African countries that are able to sequence domestically and highlight that local sequencing enables faster turnaround times and more-regular routine surveillance. Despite limitations of low testing proportions, findings from this genomic surveillance study underscore the heterogeneous nature of the pandemic and illuminate the distinct dispersal dynamics of variants of concern-particularly Alpha, Beta, Delta, and Omicron-on the continent. Sustained investment for diagnostics and genomic surveillance in Africa is needed as the virus continues to evolve while the continent faces many emerging and reemerging infectious disease threats. These investments are crucial for pandemic preparedness and response and will serve the health of the continent well into the 21st century

The evolving SARS-CoV-2 epidemic in Africa: Insights from rapidly expanding genomic surveillance

INTRODUCTION Investment in Africa over the past year with regard to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) sequencing has led to a massive increase in the number of sequences, which, to date, exceeds 100,000 sequences generated to track the pandemic on the continent. These sequences have profoundly affected how public health officials in Africa have navigated the COVID-19 pandemic. RATIONALE We demonstrate how the first 100,000 SARS-CoV-2 sequences from Africa have helped monitor the epidemic on the continent, how genomic surveillance expanded over the course of the pandemic, and how we adapted our sequencing methods to deal with an evolving virus. Finally, we also examine how viral lineages have spread across the continent in a phylogeographic framework to gain insights into the underlying temporal and spatial transmission dynamics for several variants of concern (VOCs). RESULTS Our results indicate that the number of countries in Africa that can sequence the virus within their own borders is growing and that this is coupled with a shorter turnaround time from the time of sampling to sequence submission. Ongoing evolution necessitated the continual updating of primer sets, and, as a result, eight primer sets were designed in tandem with viral evolution and used to ensure effective sequencing of the virus. The pandemic unfolded through multiple waves of infection that were each driven by distinct genetic lineages, with B.1-like ancestral strains associated with the first pandemic wave of infections in 2020. Successive waves on the continent were fueled by different VOCs, with Alpha and Beta cocirculating in distinct spatial patterns during the second wave and Delta and Omicron affecting the whole continent during the third and fourth waves, respectively. Phylogeographic reconstruction points toward distinct differences in viral importation and exportation patterns associated with the Alpha, Beta, Delta, and Omicron variants and subvariants, when considering both Africa versus the rest of the world and viral dissemination within the continent. Our epidemiological and phylogenetic inferences therefore underscore the heterogeneous nature of the pandemic on the continent and highlight key insights and challenges, for instance, recognizing the limitations of low testing proportions. We also highlight the early warning capacity that genomic surveillance in Africa has had for the rest of the world with the detection of new lineages and variants, the most recent being the characterization of various Omicron subvariants. CONCLUSION Sustained investment for diagnostics and genomic surveillance in Africa is needed as the virus continues to evolve. This is important not only to help combat SARS-CoV-2 on the continent but also because it can be used as a platform to help address the many emerging and reemerging infectious disease threats in Africa. In particular, capacity building for local sequencing within countries or within the continent should be prioritized because this is generally associated with shorter turnaround times, providing the most benefit to local public health authorities tasked with pandemic response and mitigation and allowing for the fastest reaction to localized outbreaks. These investments are crucial for pandemic preparedness and response and will serve the health of the continent well into the 21st century

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).</jats:p

Sero-molecular Prevalence of Zika Virus among Pregnant Women Attending Some Public Hospitals in Lagos State, Nigeria

Zika virus (ZIKV) is one of the arboviruses implicated in febrile illness, microcephaly and other neurological disorders in babies whose mothers were infected during pregnancy. Information on ZIKV in Nigeria is limited. Hence, this study was aimed at investigating the seroprevalence of Zika virus among pregnant women in Lagos State. In a cross-sectional study, blood samples collected from 352 randomly selected pregnant women in four hospitals in Lagos State were separated and plasma analyzed using Zika virus IgG and IgM capture Enzyme-linked immunosorbent assay (Demeditec Diagnostics, Germany). The optical densities were read using Precision Microplate reader (Molecular devices) and cut-off calculated according to manufacturer’s guide. Parameters and symptoms such as history of fever, rashes on the body, exposure to mosquito were extracted from the questionnaire and analyzed. IgM seropositive samples were screened for ZIKV RNA on RT-qPCR. Out of 352 samples screened, 7(2.0%) and 5(1.4%) of the pregnant women tested positive for IgG and IgM respectively. None tested positive for both IgG and IgM markers. Statistical analysis showed that there is no significant relationship between the symptoms analyzed in this study at 95% Confidence interval except conjunctivitis. None of the ZIKV IgM seropositive samples tested positive for ZIKV RNA on RT-qPCR. The results show that there is evidence of exposure to Zika virus among the population studied in Lagos, Nigeria. Also, the low level seroprevalence of the virus in the population studied indicates that there is lack of herd immunity of Zika virus infection in Lagos, Nigeria.</jats:p

Surveillance of Viral Hemorrhagic Fever Viruses in Lassa Fever Suspects in Ondo State, Nigeria

Lassa Fever (LF) continues to be an endemic acute viral hemorrhagic fever (VHF) illness in Nigeria. Many suspected cases of LF infection have subsequently been confirmed negative and raises concerns as to what the diagnosis of such patients could be. Hence this study was to determine the causative agents of unconfirmed LF among initially suspected cases in South Western Nigeria. In this retrospective study, blood samples originally collected from 233 suspected cases of a LF outbreak response at Owo and Ose LGAs of Ondo State, were transported in triple level packaging and stored at -80°C. All samples were screened for LF IgM and IgG markers and LF PCR. Forty-five out of the stored plasma samples were randomly retrieved and analyzed for presence of IgM for seven other VHF viruses; Chikungunya (CHIK), West Nile (WN), Rift Valley fever (RVF), Yellow fever (YF), Dengue fever (DEN), Zika and Crimean-Congo hemorrhagic fever (CCHF). Out of 45 samples screened, 1 (2.2%) was positive for YF IgM antibody. The same sample was previously confirmed LF positive by PCR. This LF and YF co-infection was from a male, 23-year old individual. The presence of co-infections of LF and YF draw to limelight the need to be broad minded in exploring for the presence of other VHF viruses in outbreaks. Further studies are needed to decipher the diagnosis of LF suspected cases.</jats:p

Low level SARS-CoV-2 RNA detected in plasma samples from a cohort of Nigerians: Implications for blood transfusion

The present global pandemic triggered by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has lingered for over a year in its devastating effects. Diagnosis of coronavirus disease 2019 (COVID-19) is currently established with a polymerase chain reaction (PCR) test by means of oropharyngeal-, nasopharyngeal-, anal-swabs, sputum and blood plasma. However, oral and nasal swabs are more commonly used. This study, therefore, assessed sensitivity and specificity of plasma as a diagnostic in comparison with a combination of oral and nasal swab samples, and the implications for blood transfusion. Oropharyngeal (OP) and nasopharyngeal (NP) swab samples were obtained from 125 individuals suspected to have COVID-19 and stored in viral transport medium (VTM) tubes. Ten millilitres of blood samples in EDTA were also obtained by venepuncture and spun to obtain plasma. Viral RNA was obtained from both swabs and plasma by manual extraction with Qiagen QIAamp viral RNA Mini Kit. Detection was done using a real time fluorescent RT-qPCR BGI kit, on a QuantStudio 3 real-time PCR instrument. Average age of study participants was 41 years, with 74 (59.2%) being male. Out of the 125 individuals tested for COVID-19, 75 (60%) were positive by OP/NP swab. However, only 6 (4.8%) had a positive plasma result for COVID-19 with median Ct value of 32.4. Sensitivity and specificity of RT-PCR SARS-CoV-2 test using plasma was 8% and 100% respectively. There was no false positive recorded, but 69 (55.2%) false negatives were obtained by plasma. SARS-CoV-2 viral RNA was detected, albeit low (4.8%) in plasma. Plasma is likely not a suitable biological sample to diagnose acute SARS-CoV-2 infection. The implication of transfusing blood in this era of COVID-19 needs further investigations.</jats:p

Low level SARS-CoV-2 RNA detected in plasma samples from a cohort of Nigerians: Implications for blood transfusion.

The present global pandemic triggered by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has lingered for over a year in its devastating effects. Diagnosis of coronavirus disease 2019 (COVID-19) is currently established with a polymerase chain reaction (PCR) test by means of oropharyngeal-, nasopharyngeal-, anal-swabs, sputum and blood plasma. However, oral and nasal swabs are more commonly used. This study, therefore, assessed sensitivity and specificity of plasma as a diagnostic in comparison with a combination of oral and nasal swab samples, and the implications for blood transfusion. Oropharyngeal (OP) and nasopharyngeal (NP) swab samples were obtained from 125 individuals suspected to have COVID-19 and stored in viral transport medium (VTM) tubes. Ten millilitres of blood samples in EDTA were also obtained by venepuncture and spun to obtain plasma. Viral RNA was obtained from both swabs and plasma by manual extraction with Qiagen QIAamp viral RNA Mini Kit. Detection was done using a real time fluorescent RT-qPCR BGI kit, on a QuantStudio 3 real-time PCR instrument. Average age of study participants was 41 years, with 74 (59.2%) being male. Out of the 125 individuals tested for COVID-19, 75 (60%) were positive by OP/NP swab. However, only 6 (4.8%) had a positive plasma result for COVID-19 with median Ct value of 32.4. Sensitivity and specificity of RT-PCR SARS-CoV-2 test using plasma was 8% and 100% respectively. There was no false positive recorded, but 69 (55.2%) false negatives were obtained by plasma. SARS-CoV-2 viral RNA was detected, albeit low (4.8%) in plasma. Plasma is likely not a suitable biological sample to diagnose acute SARS-CoV-2 infection. The implication of transfusing blood in this era of COVID-19 needs further investigations