Top-down or Bottom-up: A decision-making framework for faecal sludge and septage management implementation in urban India

Top-down or bottom-up: a decision-making framework for faecal sludge and septage management implementation in urban Indi

LD based statistics to study the linkage disequilibrium between two unlinked loci (VDR alleles F/f, B/b, A/a and T/t and predisposing HLA-DRB1*0301, *0401, *0402 and *0405 alleles shown collectively as DR3 in the table).

#<p><i>DR3+ve</i> includes all the Predisposing Alleles i.e. <i>DRB1*0301,*0401,*0402</i> and <i>*0405</i>.</p><p>δ_A, δ_N, V_A, V_N and T1 calculated as shown in statistical methods.</p><p>Frequencies of <i>DR3</i> = 0.6, <i>F</i> = 0.76, <i>F-DR3</i> = 0.519 <i>f</i> = 0.23, <i>f-DR3</i> = 0.18, <i>B</i> = 0.59, <i>B-DR3</i> = 0.425, <i>b</i> = 0.41, <i>b-DR3</i> = 0.315, <i>A</i> = 0.642, <i>A-DR3</i> = 0.46, <i>a</i> = 0.358, <i>a-DR3</i> = 0.273, <i>T</i> = 0.624, <i>T-DR3</i> = 0.444, <i>t</i> = 0.376, <i>t-DR3</i> = 0.275 in patients and <i>DR3</i> = 0.107, <i>F</i> = 0.78, <i>F-DR3</i> = 0.105, <i>f</i> = 0.21, <i>f-DR3</i> = 0.047, <i>B</i> = 0.52, <i>B-DR3</i> = 0.086, <i>b</i> = 0.48, <i>b-DR3</i> = 0.065, <i>A</i> = 0.59, <i>A-DR3</i> = 0.094, <i>a</i> = 0.411, <i>a-DR3</i> = 0.065, <i>T</i> = 0.66 <i>T-DR3</i> = 0.0942, <i>t</i> = 0.34, <i>t-DR3</i> = 0.065 in controls. Frequencies of the <i>VDR</i> alleles are marginally different from <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0008023#pone-0008023-t001" target="_blank">Table 1</a> depending on which samples were typed for all the four loci and <i>HLA-DRB1</i> in both patients and controls.</p

Comparison of genotype frequencies of <i>VDR</i> SNPs at <i>Fok1, Bsm1, Apa</i> and <i>Taq1</i> sites in T1D patients with controls.

*<p>Corrected p (pc) value is not significant.</p><p>#Calculated using Fisher's exact test.</p><p>@HWE p value calculated using SHEsis program.</p

Comparisons of frequencies of VDR haplotypes in male and female patients with male and female controls, all controls and between male and female patients using SHEsis software.

<p>HF = Haplotype frequency.</p><p>Linkage Disequilibrium tests for Female patients using SHEsis software.</p><p>D': <i>Fok1-Bsm1</i> = 0.066, <i>Fok1-Apa1</i> = 0.042, <i>Fok1-Taq1</i> = 0.048, <i>Bsm1-Apa1</i> = 0.9, <i>Bsm1-Taq 1</i> = 0.966, <i>Apa1-Taq1</i> = 0.946.</p><p>Linkage Disequilibrium tests for Male patients using SHEsis software.</p><p>D': <i>Fok1-Bsm1</i> = 0.015, <i>Fok1-Apa1</i> = 0.03, <i>Fok1-Taq1</i> = 0.014, <i>Bsm1-Apa1</i> = 0.898, <i>Bsm1-Taq 1</i> = 0.923, <i>Apa1-Taq1</i> = 0.957.</p

Simultaneous presence of different VDR haplotypes along with predisposing HLA-DRB1^*0301, ^*0401, ^*0402 and ^*0405 alleles.

<p>No. shows the number of individual positive for the indicated VDR haplotype and <i>DR3</i> allele.</p><p>#DR3+ve includes all the Predisposing Alleles i.e. <i>DRB1*0301,*0401,*0402</i> and <i>*0405</i>.</p>*<p>Corrected P(pc) value is significant.</p>**<p>Corrected P(pc) value is not significant.</p

Flow cytometric analysis of HLA-DR expression.

<p>B-LCLs VAVY and DUCAF cells were treated with 100 nM calcitriol or equal volume of alcohol as vehicle control. Both VAVY and DUCAF cells show a significant increase in surface HLA-DR expression as determined by the geometric mean flurescence intensity of staining with HLA-DR-PE antibody. A. The figure shows mean±S.E.M. of three independent experiments. Two tailed Paired T test shows the difference to be significant with p<0.001 i.e., enhanced expression of HLA-DR in B-LCLs treated with calcitriol as compared to untreated ones. B: Line graph showing the extent of enhanced HLA-DR expression in three independent expeiments.</p

Promoter region of HLA- DRB1 was sequenced from 3 subjects suffering from type 1 diabetes and 3 normal healthy individuals homozygous for DRB1*0301.

<p>The sequence showing important regulatory elements like S-box, X-box, Y-box, CCAAY-box, TATA-box and VDRE are highlighted. Stars (*) in the last row show homology and dots (.) show nucleotide substitution in one or more samples at that particular site and dashes(-) represent gaps inserted to maximize the homology. The ID and A numbers represent the T1D and control samples sequenced respectively. The sequences have been aligned with reference sequence gi|545423|gb|S69987.1| HLA-DRB1 (DRB1*0301) {promoter} [human, lymphoblastoid cell line AVL, Genomic, 416 nt] <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0008023#pone.0008023-Emery1" target="_blank">[64]</a>.</p

The genotypes for the four SNPs were determined by PCR amplification and restriction digestion of the PCR products with enzymes <i>FokI, BsmI, ApaI</i>, and <i>TaqI</i>.

<p>A: Fok1 digestion: SNP C/T in exon 2 was studied by amplifying a 265 bp fragment using primers 5′AGCTGGCCCTGGCACTGACTCTTGCTCT 3′ and 5′ATGGAAACACCTTGCTTCTTCTCCCTC 3′ with 68°C as annealing temperature and digestion by fok1 at 37°C for 3 hours. Presence of restriction site is denoted by ‘f’ while absence of restriction is denoted by ‘F’. Results show FF (CC) i.e., a 265 bp band or Ff (CT) i.e., 265 bp, 196 bp and 69 bp, bands, ff (TT) i.e., 196 bp and 69 bp bands. M is the100 bp ladder. B: Bsm 1 digestion: SNP A/G in Intron 8 was studied by amplifying an 825 bp fragment using primers 5′CAACCAAGACTACAAGTACCGCGTCAGTGA 3′ and 5′AACCAGCGGGAAGAGGTCAAGGG 3′ with 65°C as annealing temperature and digestion by Bsm1 at 65°C for one hour. Presence of restriction site is denoted as ‘b’ and absence of restriction is denoted by ‘B’. The results show BB (AA) i.e., 825 bp band, Bb (AG) i.e., 825 bp, 650 bp and 175 bp and bands and bb (GG) 650 bp and 175 bp bands. M is 25 bp ladder. C: Apa 1 digestion: SNP T/G in Intron 8 was studied by amplifying an 740 bp fragment using primers 5′ CAGAGCATGGACAGGGAGCAAG 3′ and 5′ GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Apa1 at 37°C for one hour. Presence of restriction site is denoted as ‘a; and absence of restriction is denoted by ‘A’. The results show AA (TT) i.e., 740 bp band, Aa (TG) i.e., 740 bp, 520 bp and 220 bp bands and aa (GG) 520 bp and 220 bp bands. M is 100 bp ladder. D: Taq 1 digestion: SNP T/C in exon 9 was studied by amplifying an 740 bp fragment using primers 5′CAGAGCATGGACAGGGAGCAAG 3′ and 5′GCAACTCCTCATGGCTGAGGTCTCA 3′ with 65°C as annealing temperature and digestion by Taq1 at 65°C for one hour. Presence of restriction site is denoted as ‘t’ and absence of restriction is denoted by ‘T’. The results show TT (TT) i.e., 495 bp and 245 bp bands Tt (TC) i.e., 495 bp, 290 bp, 245 bp and 205 bp bands and tt (CC) 290 bp, 245 bp and 205 bp bands. M is 100 bp ladder.</p

LD based statistics to study the linkage disequilibrium between two unlinked loci (VDR haplotypes and predisposing HLA-DRB1*0301, *0401, *0402 and *0405 alleles shown collectively as DR3 in the table 6).

#<p><i>DR3+ve</i> includes all the Predisposing Alleles i.e. <i>DRB1*0301,*0401,*0402</i> and <i>*0405</i>.</p><p>δ_A, δ_N, V_A, V_N and T1 calculated as shown in statistical methods.</p><p>Frequencies of <i>DR3</i> = 0.6, <i>FBAT</i> = 0.12, <i>FBAT-DR3</i> = 0.107, <i>FBAt</i> = 0.33, <i>FBAt-DR3</i> = 0.24, <i>FbaT</i> = 0.264, <i>FbaT-DR3</i> = 0.216, <i>fBAT</i> = 0.088, <i>fBAT-DR3</i> = 0.075, <i>fBAt</i> = 0.034, <i>fBAt-DR3</i> = 0.03, <i>fbaT</i> = 0.079, <i>fbaT-DR3</i> = 0.062 in patients and <i>DR3</i> = 0.107, <i>FBAT</i> = 0.118, <i>FBAT-DR3</i> = 0.0183, <i>FBAt</i> = 0.233, <i>FBAt-DR3</i> = 0.055, <i>FbaT</i> = 0.369, <i>FbaT-DR3</i> = 0.063, <i>fBAT</i> = 0.052, <i>fBAT-DR3</i> = 0.0157, <i>fBAt</i> = 0.099, <i>fBAt-DR3</i> = 0.0236, <i>fbaT</i> = 0.026 and <i>fbaT-DR3</i> = 0 in controls. Frequencies of the <i>VDR</i> haplotypes are marginally different from <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0008023#pone-0008023-t002" target="_blank">Table 2</a> as these have been calculated from the reconstructed haplotypes based on SHEsis program to study interaction with predisposing <i>HLA</i> alleles, whereas <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0008023#pone-0008023-t002" target="_blank">Table 2</a> shows the frequencies as calculated by SHEsis analysis.</p

Impact of levels of total digestible nutrients on microbiome, enzyme profile and degradation of feeds in buffalo rumen

<div><p>The present study was aimed at understanding a shift in rumen microbiome of buffaloes fed various levels of total digestible nutrients. To understand the process, the metagenomics of rumen microbes, <i>in vivo</i> and <i>in vitro</i> rumen fermentation studies were carried out. Three rumen fistulated adult male Murrah buffaloes were fed three isonitrogenous diets varying in total digestible nutrients (70, 85 and 100% of TDN requirement) in 3X3 switch over design. On dry matter basis, wheat straw/ roughage content were 81, 63 and 51% and that of maize grain was 8, 16 and 21% in three diets respectively. After 20 d of feeding, rumen liquor and rumen contents were sampled just before (0h) and 4h post feeding. <i>Ruminococcus flavefaciens</i> and <i>R</i>. <i>albus</i> (estimated with real time PCR) were higher in high roughage diets. The predominant phyla in all the three groups were Bacteroidetes, Firmicutes followed by Proteobacteria, Actinobacteria and Fibrobacteres. A core group of more than fifty rumen bacteria was present in all the animals with very little variations due to level of TDN. The most predominant bacterial genera reported in order of decreasing abundance were: <i>Prevotella</i>, <i>Bacteroides</i>, <i>Clostridium</i>, <i>Ruminococcus</i>, <i>Eubacterium</i>, <i>Parabacteroides</i>, <i>Fibrobacter</i>, <i>Butyrivibrio</i> etc. The higher diversity of the enyzmes families GH 23, GH 28, GH 39, GH 97, GH 106, and GH 127 (the enzymes active in fibre and starch degradation) were significantly higher on 100%TDN diet while CE 14 (required for the hydrolysis of bond between carbohydrate and lignin) was higher on low TDN (70%) diet, indicating ester bond cleavage was better in animals fed high roughage (wheat straw) diet.</p></div