Data on retinoic acid and reduced serum concentration induced differentiation of Neuro-2a neuroblastoma cells

The present data describe the relative neuro-2a cellular differentiation induced by reducing serum concentration (0.1% FBS) in DMEM in the presence/absence of 20 μM retinoic acid (RA). Neurite outgrowth was observed within 24 h in DMEM supplemented with reduced serum and retinoic acid (GpIV). The CFSE based proliferation assay data signified cessation of neuro-2a cellular proliferation in GpIV. An increase in the number of cells arrested at G0/G1 phase was also evident in GpIV and DMEM supplemented with 0.1% FBS (GpIII). Moreover, GpIV cells had improved mRNA and protein expression of Rbfox3/NeuN and choline acetyltransferase (ChAT). Keywords: Neuro-2a, Retinoic acid, Reduced seru

Effect of Ca2EDTA on zinc mediated inflammation and neuronal apoptosis in hippocampus of an in vivo mouse model of hypobaric hypoxia.

Calcium overload has been implicated as a critical event in glutamate excitotoxicity associated neurodegeneration. Recently, zinc accumulation and its neurotoxic role similar to calcium has been proposed. Earlier, we reported that free chelatable zinc released during hypobaric hypoxia mediates neuronal damage and memory impairment. The molecular mechanism behind hypobaric hypoxia mediated neuronal damage is obscure. The role of free zinc in such neuropathological condition has not been elucidated. In the present study, we investigated the underlying role of free chelatable zinc in hypobaric hypoxia-induced neuronal inflammation and apoptosis resulting in hippocampal damage.Adult male Balb/c mice were exposed to hypobaric hypoxia and treated with saline or Ca2EDTA (1.25 mM/kg i.p) daily for four days. The effects of Ca2EDTA on apoptosis (caspases activity and DNA fragmentation), pro-inflammatory markers (iNOS, TNF-α and COX-2), NADPH oxidase activity, poly(ADP ribose) polymerase (PARP) activity and expressions of Bax, Bcl-2, HIF-1α, metallothionein-3, ZnT-1 and ZIP-6 were examined in the hippocampal region of brain.Hypobaric hypoxia resulted in increased expression of metallothionein-3 and zinc transporters (ZnT-1 and ZIP-6). Hypobaric hypoxia elicited an oxidative stress and inflammatory response characterized by elevated NADPH oxidase activity and up-regulation of iNOS, COX-2 and TNF-α. Furthermore, hypobaric hypoxia induced HIF-1α protein expression, PARP activation and apoptosis in the hippocampus. Administration of Ca2EDTA significantly attenuated the hypobaric hypoxia induced oxidative stress, inflammation and apoptosis in the hippocampus.We propose that hypobaric hypoxia/reperfusion instigates free chelatable zinc imbalance in brain associated with neuroinflammation and neuronal apoptosis. Therefore, zinc chelating strategies which block zinc mediated neuronal damage linked with cerebral hypoxia and other neurodegenerative conditions can be designed in future

A comparison of intrathecal dexmedetomidine, clonidine, and fentanyl as adjuvants to hyperbaric bupivacaine for lower limb surgery: A double blind controlled study

Background: Various adjuvants are being used with local anesthetics for prolongation of intraoperative and postoperative analgesia. Dexmedetomidine, the highly selective 2 adrenergic agonist is a new neuraxial adjuvant gaining popularity. Aim: The purpose of this study was to compare the onset, duration of sensory and motor block, hemodynamic effects, postoperative analgesia, and adverse effects of dexmedetomidine, clonidine, and fentanyl used intrathecally with hyperbaric 0.5% bupivacaine for spinal anesthesia. Settings and Design: The study was conducted in prospective, double blind manner. It included 120 American Society of Anesthesiology (ASA) class I and II patients undergoing lower limb surgery under spinal anesthesia after approval from hospital ethics committee with written and informed consent of patients. Materials and Methods: The patients were randomly allocated into four groups (30 patients each). Group BS received 12.5 mg hyperbaric bupivacaine with normal saline, group BF received 12.5 mg bupivacaine with 25 g fentanyl, group BC received 12.5 mg of bupivacaine supplemented 30 g clonidine, and group BD received 12.5 mg bupivacaine plus 5 g dexmedetomidine. The onset time to reach peak sensory and motor level, the regression time of sensory and motor block, hemodynamic changes, and side effects were recorded. Results: Patients in Group BD had significantly longer sensory and motor block times than patients in Groups BC, BF, and BS with Groups BC and BF having comparable duration of sensory and motor block. The mean time of two segment sensory block regression was 147 ± 21 min in Group BD, 117 ± 22 in Group BC, 119 ± 23 in Group BF, and 102 ± 17 in Group BS (P < 0.0001). The regression time of motor block to reach modified Bromage zero (0) was 275 ± 25, 199 ± 26, 196 ± 27, 161 ± 20 in Group BD, BC, BF, and BS, respectively (P < 0.0001). The onset times to reach T8 dermatome and modified Bromage 3 motor block were not significantly different between the groups. Dexmedetomidine group showed significantly less and delayed requirement of rescue analgesic. Conclusions: Intrathecal dexmedetomidine is associated with prolonged motor and sensory block, hemodynamic stability, and reduced demand of rescue analgesics in 24 h as compared to clonidine, fentanyl, or lone bupivacaine

Effect of free chelatable zinc on hypobaric hypoxia induced apoptosis.

<p>A. Photomicrographs of TUNEL stained hippocampus CA3 region (A) of normoxia (a), normoxia treated with Ca₂EDTA (b), hypoxia (c), and hypoxia treated with Ca₂EDTA (d) (Magnification 400X). Arrow head shows TUNEL positive neurons. Graph (B) represents the number of TUNEL positive neurons from the sections of hippocampus CA3 region, caspase 9 (C), caspase 8 (D) and caspase 3 (E) activities. *** indicate p<0.01, **, ## indicate p<0.01. * compared hypoxia vs normoxia and normoxia treated Ca₂EDTA and hypoxia treated with Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. N- Normoxia, NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA. Scale bar  = 5 µm.</p

Schematic illustration of the role of free chelatable zinc during hypoxic conditions.

<p>Zinc chelator alters the accumulation of free zinc in the hippocampus thus, reduces oxidative stress and inhibits PARP activation. Oxidative stress and PARP collectively modulate Bcl-2 expression resulting in Bax mediated activation of caspases leading to apoptotic neurodegeneration during hypoxic stress which is reduced significantly by the treatment zinc chelator.</p

Effect of free chelatable zinc on hypobaric hypoxia induced alteration in Bax/Bcl-2 expression.

<p>Graph represents the relative mRNA expression of Bax/Bcl-2 in the hippocampus (A). Lane 1-Normoxia, Lane 2-Normoxia treated with Ca₂EDTA, Lane 3- Hypoxia and Lane 4- Hypoxia treated with Ca₂EDTA. Graph (B) represents the relative protein expression of Bax/Bcl-2 in the hippocampus. Lane 1-Normoxia, Lane 2-Normoxia treated with Ca₂EDTA, Lane 3- Hypoxia and Lane 4- Hypoxia treated with Ca₂EDTA. *, # indicate p<0.05. ***, ### indicate p<0.001. * compared hypoxia vs normoxia and normoxia treated Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. N- Normoxia, NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA. Bcl-2: Forward -5′-CTGGCATCTTCTCCTTCCAG-3′; Reverse - 5′-GACGGTAGCGACGAGAGAAG-3′ (183 bp); Bax: Forward: 5′-TGAAGACAGGGGCCTTTTTG-3′; Reverse: 5′-AATTCGCCGGAGACACTCG-3′ (139 bp).</p

Effect of Ca₂EDTA on hypobaric hypoxia induced alteration in the expression of inflammatory mediators.

<p>Photomicrographs show the expression of iNOS (A), COX-2 (C) and TNF-α (E), counter stained with Hoechst 33342 on CA3 hippocampal regions of normoxia (a), normoxia treated with Ca₂EDTA (b), hypoxia (c), hypoxia treated with Ca₂EDTA (d) (Magnification ×400). Graph represents relative mean fluorescence intensity of iNOS (B), COX-2 (D) and TNF-α (F) expression in hippocampal sections of CA3 region. *** indicate p<0.001, **, ## indicate p<0.01, # indicate p<0.05. * compared hypoxia vs normoxia treated Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. NED-normoxia treated with Ca₂EDTA, IH-hypoxia and HED-hypoxia treated with Ca₂EDTA. Scale bar  = 5 µm.</p

Effect of Ca₂EDTA on hypobaric hypoxia induced alteration in expression of HIF-1α.

<p>Photomicrographs show the expression of HIF-1α counter stained with Hoechst 33342 (A) in CA3 hippocampal region of normoxia (a), normoxia treated with Ca₂EDTA (b), hypoxia (c) and hypoxia treated with Ca₂EDTA (d) (Magnification ×400). Graph represents relative mean fluorescence intensity of HIF-1α expression in hippocampal sections of CA3 region (B) and <i>HIF-1α</i> mRNA (216 bp) expression and relative OD (C) in hippocampus. *** indicate p<0.001;* compared hypoxia vs normoxia treated with Ca₂EDTA. ## indicate p<0.01, # compared hypoxia hreated Ca₂EDTA vs hypoxia. NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA. Lane 1,2-Normoxia, Lane 3,4-Normoxia treated with Ca₂EDTA, Lane 5,6- Hypoxia and Lane 7,8- Hypoxia treated with Ca₂EDTA. M indicate Marker lane. <i>HIF-1α</i> – Forward primer: 5′ - AGAAACCTACCATCACTGCCACT- 3′, Reverse primer: 5′ – TGTTCTATGACTCTCTTTCCTGC - 3′ (216 bp). Scale bar  = 5 µm.</p

A comparative study of low concentration of levobupivacaine versus ropivacaine with fentanyl for patient-controlled epidural labour analgesia

>Background and Aims: Lumbar epidural analgesia is considered the modality of choice for labour analgesia. Despite its super analgesia and improved safety profile, it has been associated with maternal adverse effects like higher incidence of instrumental assisted vaginal delivery (AVD) and motor block leading to decreased ambulation. This study was designed to evaluate the efficacy of low concentrations of local anaesthetics (0.1% ropivacaine and 0.1% levobupivacaine) with 2 μg/ml fentanyl as a patient controlled epidural analgesia (PCEA) technique on the incidence of instrumental AVD along with evaluation of obstetric, maternal, and foetal outcomes.Materials and Methods: In this prospective study, 60 labouring parturients were randomly allocated into two equal groups to receive either 0.1% ropivacaine with 2 μg/ml fentanyl or 0.1% levobupivacaine with 2 μg/ml fentanyl as epidural solutions via PCEA pump infusions (4 ml/h) after 15 ml loading dose of the respective solutions. The incidence of instrumental AVD was noted as the primary outcome along with demographic data, maternal and foetal vital parameters, maternal VAS scores, degree of motor blockade and total epidural drug consumption.Results: The incidence of instrumental AVD was found to be 43.3% in the levobupivacaine group and 30% in the ropivacaine group. This difference was not statistically significant. Both the groups were comparable in terms of demographic data, maternal VAS scores, total epidural drug consumption and foetal APGAR scores.Conclusion: The use of newer local anaesthetics (levobupivacaine and ropivacaine) in low concentrations with opioids (fentanyl) as a PCEA technique may offer high maternal satisfaction in terms of quality of pain relief with fewer adverse events like instrumental AVD and adverse foetal outcomes

Effect of Ca₂EDTA on nitrite content, NADPH oxidase activity, LPO level, and PARPactivity.

<p>Graph represents the total nitrite level (A), NADPH Oxidase activity (B), lipid peroxidation (C) and PARP activity assay (D) in the hippocampal tissue homogenate. ***, ### indicate p<0.001, **, ## indicate p<0.01. * compared hypoxia vs normoxia and normoxia treated Ca₂EDTA, # compared hypoxia treated Ca₂EDTA vs hypoxia. N-Normoxia, NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA.</p