Primary and secondary oxidative stress in Bacillus

Coping with oxidative stress originating from oxidizing compounds or reactive oxygen species (ROS), associated with the exposure to agents that cause environmental stresses, is one of the prerequisites for an aerobic lifestyle of Bacillus spp. such as B. subtilis, B. cereus and B. anthracis. This minireview highlights novel insights in the primary oxidative stress response caused by oxidizing compounds including hydrogen peroxide and the secondary oxidative stress responses apparent upon exposure to a range of agents and conditions leading to environmental stresses such as antibiotics, heat and acid. Insights in the pathways and damaging radicals involved have been compiled based among others on transcriptome studies, network analyses and fluorescence techniques for detection of ROS at single cell level. Exploitation of the current knowledge for the control of spoilage and pathogenic bacteria is discussed

Bacillus cereus responses to acid stress

Coping with acid environments is one of the prerequisites for the soil saprophytic and human pathogenic lifestyle of Bacillus cereus. This minireview highlights novel insights in the responses displayed by vegetative cells and germinating spores of B. cereus upon exposure to low pH as well as organic acids, including acetic acid, lactic acid and sorbic acid. Insights regarding the possible acid-inflicted damage, physiological responses and protective mechanisms have been compiled based on single cell fluorescence microscopy, flow cytometry and transcriptome analyses

Impact of sorbic acid on germinant receptor-dependent and -independent germination pathways in Bacillus cereus

Amino acid- and inosine-induced germination of Bacillus cereus ATCC 14579 spores was reversibly inhibited in the presence of 3 mM undissociated sorbic acid. Exposure to high hydrostatic pressure, Ca-dipicolinic acid (DPA), and bryostatin, an activator of PrkC kinase, negated this inhibition, pointing to specific blockage of signal transduction in germinant receptor-mediated germination

Comparative analysis of Bacillus weihenstephanensis KBAB4 spores obtained at different temperatures

The impact of Bacillus weihenstephanensis KBAB4 sporulation temperature history was assessed on spore heat resistance, germination and outgrowth capacity at a temperature range from 7 to 30 °C. Sporulation rate and efficiency decreased at low temperature, as cells sporulated at 12, 20 and 30 °C with approximately 99% efficiency, whereas at 7 °C and 10 °C, a maximum 15% of sporulation was reached. Spores formed at 30 °C showed the highest wet heat resistance at 95 °C, with spores formed at 7 and 10 °C displaying only survival of 15 min exposure at 70 °C, indicating their low level heat resistance. RT-PCR analysis revealed expression of sporulation sigma factor sigG, and germinant receptor operons gerI, gerK, gerL, gerR, gerS, and (plasmid-located) gerS2 to be activated in all sporulation conditions tested. Subsequent germination assays revealed a combination of inosine and L-Alanine to be very efficient, triggering over 99% of the spores to germinate, with spores obtained at 30 °C showing the highest germination rates (99%). Notably, spores obtained at 12, 20 and 30 °C, germinated at all tested temperatures, showing > 70% spore germination even at temperatures as low as 5 °C. Less than 5% of spores obtained at 7 and 10 °C showed a germination response. Furthermore, spores produced at 12, 20 and 30 °C showed similar outgrowth effiency at these temperatures, indicating that low temperature sporulation history does not improve low temperature outgrowth performance. Insights obtained in sporulation and germination behaviour of B. weihenstephanensis KBAB4, in combination with the availability of its genome sequence, may contribute to our understanding of the behaviour of psychrotolerant spoilage and pathogenic Bacill

Analysis of acid-stressed Bacillus cereus reveals a major oxidative response and inactivation-associated radical formation

Acid stress resistance of the food-borne human pathogen Bacillus cereus may contribute to its survival in acidic environments, such as encountered in soil, food and the human gastrointestinal tract. The acid stress responses of B. cereus strains ATCC 14579 and ATCC 10987 were analysed in aerobically grown cultures acidified to pH values ranging from pH 5.4 to pH 4.4 with HCI. Comparative phenotype and transcriptome analyses revealed three acid stressinduced responses in this pH range: growth rate reduction, growth arrest and loss of viability. These physiological responses showed to be associated with metabolic shifts and the induction of general stress response mechanisms with a major oxidative component, including upregulation of catalases and superoxide dismutases. Flow cytometry analysis in combination with the hydroxyl (OH center dot) and peroxynitrite (ONOO-)-specific fluorescent probe 3'-(phydroxyphenyl) fluorescein (HPF) showed excessive radicals to be formed in both B. cereus strains in bactericidal conditions only. Our study shows that radicals can indicate acid-induced malfunctioning of cellular processes that lead to cell death

Germinant receptor diversity and germination responses of four strains of the Bacillus cereus group

Four strains of the Bacillus cereus group were compared for their germinant receptor composition and spore germination capacity. Phylogenetic analysis of the germinant receptor encoding operons of the enterotoxic strains B. cereus ATCC 14579 and ATCC 10987, the emetic strain AH187, and the psychrotolerant strain Bacillus weihenstephanensis KBAB4, indicated a core group of five germinant receptor operons to be present in the four strains, with each strain containing one to three additional receptors. Using quantitative PCR, induction of expression during sporulation was confirmed for all identified germinant receptor operons in these strains. Despite the large overlap in receptors, diversity in amino acid-induced germination capacity was observed, with six out of 20 amino acids, serving as germinants for spores of all four strains. Each strain showed unique features: efficient germination of strain KBAB4 spores required non-inducing amounts of inosine as the co-germinant, strain ATCC 10987 spores germinated only efficiently after heat activation. Furthermore, strain ATCC 14579 and AH187 spores germinated without heat activation or inosine, with strain ATCC 14579 spores being triggered by all amino acids except phenylalanine and strain AH187 spores being specifically triggered efficiently only by phenylalanine. Analysis of all germination data did not reveal strict linkages between specific germinants and germinant receptors. Finally, the diversity in nutrient-induced germination capacity was also reflected in the diverse germination responses of heat-activated spores of the four B. cereus strains in food matrices, such as milk, rice water and meat bouillon, indicating that amino acid composition and/or availability of inosine are important germination determinants in foods. Keywords: Ger operon; Food preservation; B. weihenstephanensis; Sporulatio

On Equivalence of Critical Collapse of Non-Abelian Fields

We continue our study of the gravitational collapse of spherically symmetric skyrmions. For certain families of initial data, we find the discretely self-similar Type II critical transition characterized by the mass scaling exponent $\gamma \approx 0.20$ and the echoing period $\Delta \approx 0.74$. We argue that the coincidence of these critical exponents with those found previously in the Einstein-Yang-Mills model is not accidental but, in fact, the two models belong to the same universality class.Comment: 7 pages, REVTex, 2 figures included, accepted for publication in Physical Review

Probing the Light Pseudoscalar Window

Very light pseudoscalars can arise from the symmetry-breaking sector in many extensions of the Standard Model. If their mass is below 200 MeV, they can be long-lived and have interesting phenomenology. We discuss the experimental constraints on several models with light pseudoscalars, including one in which the pseudoscalar is naturally fermiophobic. Taking into account the stringent bounds from rare K and B decays, we find allowed parameter space in each model that may be accessible in direct production experiments. In particular, we study the photoproduction of light pseudoscalars at Jefferson Lab and conclude that a beam dump experiment could explore some of the allowed parameter space of these models.Comment: 22 pages, 4 figure

Soya bean tempe extracts show antibacterial activity against Bacillus cereus cells and spores

Aims: Tempe, a Rhizopus ssp.-fermented soya bean food product, was investigated for bacteriostatic and/or bactericidal effects against cells and spores of the food-borne pathogen Bacillus cereus. Methods and results: Tempe extract showed a high antibacterial activity against B. cereus ATCC 14579 based on optical density and viable count measurements. This growth inhibition was manifested by a 4 log CFU ml-1 reduction, within the first 15 min of exposure. Tempe extracts also rapidly inactivated B. cereus spores upon germination. Viability and membrane permeability assessments using fluorescence probes showed rapid inactivation and permeabilization of the cytoplasmic membrane confirming the bactericidal mode of action. Cooked beans and Rhizopus grown on different media did not show antibacterial activity, indicating the unique association of the antibacterial activity with tempe. Subsequent characterization of the antibacterial activity revealed that heat treatment and protease addition nullified the bactericidal effect, indicating the proteinaceous nature of the bioactive compound. Conclusions: During fermentation of soya beans with Rhizopus, compounds are released with extensive antibacterial activity against B. cereus cells and spores. Significance and Impact of Study: The results show the potential of producing natural antibacterial compounds that could be used as ingredients in food preservation and pathogen contro

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos