Reactivity of human and porcine natural interferon-alpha producing cells to immunostimulatory DNA

The interferon-α (IFN-α) inducing capacity of various forms of immunostimulatory DNA and the identity of the IFN-α producing cells (IPC) were studied in human and porcine leukocytes. The DNA vaccine vector pcDNA3 induced production of IFN-α in porcine peripheral blood mononuclear cells (PBMC), but only if used with the transfecting agent lipofectin. Unmethylated CpG dinucleotides in the plasmid were necessary for induction of IFN-α, but pcDNA3 retained this ability after mutation of the CpG-motifs (5’AACGTT 3’) in the ampicillin resistance gene. Lipofection and presence of an unmethylated CpG were also prerequisites for the ability of the double stranded (ds) phosphodiester oligodeoxyribonucleotide (ODN) H (5’ TTTTCAATTCGAAGATGAAT 3’) to activate production of IFN-α in human and porcine PBMC. Human, but not porcine, PBMC could still produce high levels of IFN-α in response to certain single stranded (ss) ODNs, devoid of unmethylated CpG dinucleotides. This indicates that there are species differences in the recognition of immunostimulatory DNA and that eukaryotic DNA sometimes can be interferogenic. Certain CpG-containing ODNs with flanking poly-G sequences were very potent inducers of IFN-α production in the absence of lipofectin, both as phosphorothioate/ phosphodiester chimeric ODNs or as phosphodiester ODNs. Addition of poly-G sequences to the phosphodiester ODN H clearly enhanced its activity, but did not replace the need for lipofectin. The natural IFN-α producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), were the only cells among human or porcine PBMC that produced IFN-α in response to immunostimulatory DNA. The human NIPC/PDC also produce IFN-α in response to apoptotic cells in combination with autoantibodies from patients with systemic lupus erythematosus (SLE). This activation was dependent on Fcγ-receptor type II (FcγRII), and the NIPC/PDC were shown to express FcγRIIa, but not the FcγRIIb/c isoforms. The FcγRIIa may also be inhibitory, because aggregated IgG that binds FcγR had a general inhibitory effect on IFN-α production induced by immunostimulatory DNA or herpes simplex virus. Elucidation of the mechanisms whereby NIPC/PDC are activated may result in more efficient vaccine adjuvants and also provide new targets aiming at inhibition of the pathologic activation of NIPC/PDC in autoimmune diseases

Identification and characterization of nanobodies targeting the EphA4 receptor

The ephrin receptor A4 (EphA4) is one of the receptors in the ephrin system that plays a pivotal role in a variety of cell-cell interactions, mostly studied during development. In addition, EphA4 has been found to play a role in cancer biology as well as in the pathogenesis of several neurological disorders such as stroke, spinal cord injury, multiple sclerosis, amyotrophic lateral sclerosis (ALS), and Alzheimer's disease. Pharmacological blocking of EphA4 has been suggested to be a therapeutic strategy for these disorders. Therefore, the aim of our study was to generate potent and selective Nanobodies against the ligand-binding domain of the human EphA4 receptor. Weidentified two Nanobodies, Nb 39 and Nb 53, that bind EphA4 with affinities in the nanomolar range. These Nanobodies were most selective for EphA4, with residual binding to EphA7 only. Using Alphascreen technology, we found that both Nanobodies displaced all known EphA4-binding ephrins from the receptor. Furthermore, Nb39 andNb53 inhibited ephrin-induced phosphorylationoftheEphA4proteininacell-basedassay. Finally, in a cortical neuron primary culture, both Nanobodies were able to inhibit endogenous EphA4-mediated growth-cone collapse induced by ephrin-B3. Our results demonstrate the potential of Nanobodies to target the ligand-binding domain of EphA4. These Nanobodiesmaydeservefurtherevaluationaspotentialtherapeutics in disorders in which EphA4-mediated signaling plays a role

Structure and expression of the beta1, 4-galactosyltransferase gene in relation to IgG glycosylation

Rheumatoid arthritis (RA) is associated with an increase in the level of serum IgG glycoforms lacking terminal galactose residues (i.e., agalactosyl IgG). The agalactosyl IgG shows altered effector functions and there is evidence that it may be pathogenic. Furthermore, levels of agalactosyl IgG have been shown to have a predictive value in RA. There is evidence that the decreased galactosylation of IgG occurs as a pre-secretory event and there are several reports relating this defect to aberrant control of the enzyme β1,4-galactosyltransferase (β1,4-GalTase). This project aimed to examine the structure and expression of the β1,4-GalTase gene in human RA and also in a murine model of arthritis, MRL/Mp-lpr/lpr (MRL lpr/lpr), which shows the same defect in IgG galactosylation. No gross structural alteration of the gene was observed in human RA nor in the MRL lpr/lpr mice, using restriction fragment length polymorphism analysis. An RNase protection assay established that there are similar levels of β1,4-GalTase gene expression in CD19+ cells isolated from peripheral blood of RA patients and normal healthy individuals. IgG-expressing lymphocytes isolated from spleens and lymph nodes of MRL lpr/lpr and CBA/Ca (which exhibit normally galactosylated IgG) mice also showed comparable levels of β1,4-GalTase mRNA. The known pregnancy associated increase in IgG galactosylation was examined in the Balb/c mice. Although the β1,4-GalTase transcription was highly upregulated in the mammary gland in the third trimester of pregnancy and into lactation, no changes in the mRNA and enzyme levels were observed in the lymphocytes isolated from spleens of these mice. The cytokines IL-6 and TNF-? are proposed as glycosylation regulating factors. In addition, IL-6 has been shown to be associated with increased agalactosyl IgG. Therefore, the level of β1,4-GalTase gene expression was measured in IL-6 and TNF-α transgenic mice in relation to the IgG galactosylation level. In these studies, comparable levels of β1,4-GalTase mRNA were observed in the transgenics and their littermates in both cases. Peripheral blood lymphocytes stimulated in vitro with the mitogens PHA, phorbol ester and pokeweed, with the cytokines IL-6 and TNF-α, with the calcium ionophore ionomycin and with the cAMP-inducer forskolin, did not show altered levels of β1,4-GalTase mRNA. However, the addition of prolactin to peripheral blood B cells cultured in the presence of anti-IgM plus IL-2 resulted in a small increase in mRNA levels but with no concomitant increase in IgG galactose. In conclusion, these studies indicate that IgG galactosylation is not regulated at the level of β1,4-GalTase gene expression

CD33-Related Siglecs in Early Recognition of Tumour Cells and Viruses by Mononuclear Phagocytes

The sialic acid binding immunoglobulin-like lectins (siglecs) comprise a family of receptors that are differentially expressed on leukocytes and other immune cells. Their molecular properties and the presence of tyrosine-based motifs suggest that they could be involved in fine-tuning the immune responses. Peripheral blood derived monocytes express siglec-3, -5, -7, -9, and -10 (1-10% monocyte population). Upon differentiation to macrophages a general trend of decrease in siglec-3, -5 and -9 and increase for siglec-7 expression was observed. The level of expression and degree of change during differentiation varied between individual donors. It is of special interest that siglec expression on mononuclear phagocytes is further regulated by different cytokines (IFN-gamma: increased siglec-1 and decrease siglec-5, -7 and -9; IL-4: increased siglec-7 and 9 and decrease siglec-1). Six month monocyte surface siglec expression analysis of the 15 volunteers revealed that, siglec-9 shows the most diverse expression pattern as compared to the other monocyte limited siglecs, and these changes in expression pattern has direct relation with serum CRP levels. Furthermore, co-culturing monocytes with viruses revealed that mere presence of viral particles affects monocyte surface siglec expression profile. In addition, the viral dose and time of incubation contribute to these changes. The alteration in the siglec expression pattern in response to pathogens/tumour cells could be part of the host defence system. K562 erythroleukemia tumour cells were able to elicit early sialic acid (Sia) dependent cytokine secretion by mononuclear phagocytes. And this early cytokine secretion by mononuclear phagocytes upon co-culture with K562 surface Sia derivatives was confirmed with real time IL-6 mRNA synthesis. Furthermore, an accumulation of siglec-7 was observed at the cellular synapses between these two cell types. As siglecs are the only Sia recognising receptors present on innate immune system cells, and they could be involved in the observed Sia mediated activation processes. Here it is shown that siglec-7 could plays an important role in controlling the Sia mediated activation of mononuclear phagocytes by K562 tumour cells, as in presence of anti siglec-7 mAb activation of mononuclear phagocytes is reduced by 30-40%

Entdeckung neuer therapeutischer Antikörper und Targets mittels Tumor-infiltrierender B-Zellen

Tumor-infiltrating lymphocytes (TIL) have been shown to contribute to anti-tumor immunity and improved survival in different types of cancer. Due to the close proximity to lymphatic tissue and the high frequency of related viral infections, head and neck cancers belong to the most highly infiltrated tumor types. Patients often benefit from immunotherapy, which enhances their own anti-tumor immune response, but further development of efficient strategies is limited by the discovery of novel antibodies and targets. TIL-B cells have been described to deliver novel anti-tumor antibodies in many cancer types but published investigations on head and neck cancers are rare. In the present study, novel antibodies against cancer-related proteins were isolated using the antibody repertoire of TIL-Bs of head and neck cancers. Antibody libraries were constructed based on TIL-Bs isolated from fresh tumor tissue, analysed in next generation sequencing (NGS) and used for phage display. NGS revealed an altered V-gene distribution within the TIL-B libraries compared to published naïve scFv-libraries, which in some characteristics was more similar to the V-gene usage of antigen-experienced B cells. Antibodies against the cancer target matrix metalloproteinase 9 (MMP-9) were isolated and characterised proving the presence of cancer-related antibodies within the TIL-B repertoire. Furthermore, TIL-B libraries were panned against the pharyngeal carcinoma cell line FaDu. Targets of the cell- binding antibodies were identified by immunoprecipitation and mass spectrometry revealing that nine bound to the cancer-related proteins integrin-a3ß1, CD9 and CD71. Among each other, some of these antibodies showed an identical V-gene recombination and frequent point mutations indicating clonal relation. Characterisation of the isolated antibodies revealed low cross-reactivity and affine binding to their target in various applications including ELISA, immunoprecipitation, flow cytometry and biolayer interferometry. In conclusion, the identification of antibodies against four cancer-related targets from TIL-B libraries demonstrated their vast potential in the discovery of novel anti-tumor antibodies. The observed altered V-gene distribution and the isolation of related, highly mutated antibodies indicate, that they may have contributed to an anti-tumor immune response within the patients. This approach may lead to the identification of novel targets for the development of therapeutic strategies.Ein Zusammenhang von Tumor-infiltrierenden Lymphozyten (TIL) mit einer erhöhten Überlebensrate und verbesserten Prognose wurde für mehrere Krebsarten beschrieben. Durch die Nähe zu lymphatischem Gewebe und einer häufig begleitend auftretenden viralen Infektion, zählen Kopf-Hals-Karzinome zu den am stärksten infiltrierten Tumorarten. Die Patienten profitieren oft von Immuntherapien, die die körpereigene Immunabwehr gegen den Tumor verstärken. Die Entwicklung solcher Therapien ist jedoch durch die Entdeckung neuer Zielproteine und Antikörper limitiert. TIL-B-Zellen wurden in mehreren Krebsarten als Quelle neuer anti-Tumor-Antikörper beschrieben, Untersuchungen von Kopf-Hals-Karzinomen sind jedoch selten. In dieser Arbeit wurden Tumor-assoziierte Antikörper aus dem TIL-B Repertoire von Kopf- Hals-Karzinom-Patienten identifiziert. TIL-Bs wurden aus frischem Tumormaterial isoliert, für die Konstruktion humaner Antikörper-Bibliotheken genutzt und mittels NGS (engl.: next generation sequencing) analysiert. Die TIL-B Bibliotheken wiesen eine veränderte V- Genverteilung auf, die teilweise der von Antigen-erfahrenen B-Zellen gleicht. Um zu bestätigen, dass die TIL-B Bibliotheken Tumor-assoziierte Antikörper enthalten, wurden Antikörper gegen den Tumormarker MMP-9 mittels Phagen Display isoliert und charakterisiert. Weiterhin wurde eine Selektion auf der Pharynx-Karzinom-Zelllinie FaDu durchgeführt. Die Zielproteine der Zell-bindenden Antikörper wurden mittels Immunpräzipitation und Massenspektrometrie identifiziert, wobei neun Antikörper die Tumor- assoziierten Proteine Integrin-a3ß1, CD9 und CD71 banden. Einige der isolierten Antikörper wiesen eine identische V-Genrekombination und eine Vielzahl von Punktmutationen auf, was eine klonale Verbindung vermuten lässt. Die Antikörper banden ihr Zielprotein mit vernachlässigbarer Kreuzreaktivität und hoher Affinität in verschieden Assays einschließlich ELISA, Immunpräzipitation, Durchflusszytometrie und Bio-Layer Interferometrie. Die Identifikation von Antikörpern gegen vier Tumor-assoziierte Proteine aus dem Repertoire von TIL-Bs demonstriert ihr großes Potential in der Entdeckung neuer anti-Tumor Antikörper. Die Beobachtung einer veränderten V-Genverteilung und die Anreicherung stark mutierter Antikörper weisen auf eine potentiell Tumor-induzierte Immunrektion in den betrachteten Patienten hin. Dieser Ansatz könnte zur Identifikation neuer Tumor-selektiver Zielproteine für die Entwicklung therapeutischer Strategien führen

Development of a CD22-specific chimeric antigen receptor (CAR) for the adoptive T cell therapy of leukemia and lymphoma

Ex vivo engineering of patient T cells for the specific redirection toward cancer cells is a promising immunotherapeutic strategy to treat hematological malignancies. In this doctoral thesis, a novel CD22 specific chimeric antigen receptor (CAR) was generated for the adoptive T cell therapy of CD22 positive leukemia and lymphoma. The humanized anti-CD22 (hCD22) single chain variable fragment (scFv) was used as antigen binding domain of a third generation CAR, comprising the signal transduction domains CD3ζ, CD28 and 4-1BB. Due to its high affinity and biophysical stability, the hCD22 scFv was compared to the murine anti-CD22 antibody fragment (mCD22) in terms of scFv and CAR stability. Furthermore, to enhance clinical CAR efficacy and CAR safety, the hCD22 CAR was optimized by mutagenesis. Stability experiments revealed that the mCD22 scFv has a high stability in human serum, comparable to its derived hCD22 scFv. CD22 specific activation of T cells expressing the corresponding hCD22 or mCD22 CAR proved biophysical stability of both scFv derived CARs. By mutating the hCD22 CAR human Fc spacer domain (ΔFc), binding to human Fc receptor expressing cells was blocked, thus reducing on-target, off-tumor CAR related toxicity. The blocking of interleukin-2 (IL-2) secretion caused by the LCK mutation introduced in the hCD22 CAR CD28 signaling domain (ΔCD28) needs to be further investigated as absence of IL-2 release was observed for both the parental and the mutated hCD22 CAR variants. Specific CAR T cell activation was observed for the parental, the ΔFc, the ΔCD28 and the double mutated ΔFc-ΔCD28 hCD22 CAR confirming that both introduced mutations did not affect CAR efficacy in vitro. However, the ΔFc-ΔCD28 hCD22 CAR exhibited a slightly lower anti-tumor efficacy in comparison to the ΔFc, the ΔCD28 and the parental hCD22 CAR. By additionally engineering the hCD22 scFv to further improve the stability of the derived ΔFc-ΔCD28 CAR, CAR T cell activation was not enhanced. This doctoral thesis provides the basis for the clinical development of a novel CD22 CAR T cell therapy for the treatment of CD22 positive leukemia and lymphoma

Phagocytosis and MHC II antigen presentation by human gamma delta T cells

γδ T cells are a rare subset of T cells present in human blood and lymphoid tissues. Functionally, they stand at the interface of the innate and the acquired branch of the immune system as they express somatically rearranged antigen receptors but they also share many characteristics with NK cells. One of those is the ability to express CD16. CD16 is a cell-surface receptor that binds the Fc portion of IgG. In the isoform found on tissue macrophages and NK cells it is coupled to an intracellular signalling domain that allows it to initiate cellular processes leading to the internalisation of IgG-coated particles or cytotoxicity against IgG-coated cells. Therefore, it has a role in the clearance of IgG-coated complexes and the destruction of infected or malignant cells. In this thesis, I show that a population of γδ T cells present in human blood from healthy donors express the CD16 receptor and implicate a role for this receptor in phagocytosis of IgG-coated bacteria and synthetic beads coated with recombinant influenza M1 protein. These cells were subsequently shown to activate influenza-specific T cells through MHC II presentation. Importantly, neither αβ T cells nor NK cells were capable of significant phagocytosis. In addition, once CD11c+ cells had been removed from the NK fraction, neither αβ T cells or NK cells were capable of MHC II antigen presentation of influenza M1 antigen. The CD16+ γδ T cells displayed a phenotype of effector memory and late effector memory T cells suggesting a role for these cells in patrolling the blood and rapidly migrating to sites of inflammation for a combination of rapid effector and antigen presentation function

Aggregates in blood filter chambers used from the plasma donations of anti-D donors: evaluation for monoclonal antibody discovery using phage display.

BACKGROUND: RhD-immunoglobulin (RhIg) prevents anti-D alloimmunisation in D-negative pregnant women when the fetus is D-positive, reducing the incidence of haemolytic disease of the fetus and newborn. Manufacturing RhIg is reliant on the limited supply of plasma donations with anti-D antibodies. Monoclonal antibody (mAb) development platforms such as phage display, require blood samples to be collected from anti-D donors, which may be a complicated process. The blood filter chamber (BFC) discarded after an anti-D donor's donation might provide a source of Ig-encoding RNA. This study aims to evaluate whether used BFCs are a suitable source of Ig-encoding RNA for phage display. MATERIAL AND METHODS: Haemonetics PCS2 BFCs were obtained from 10 anti-D donors for total RNA extraction, cDNA synthesis and amplification of VH and VL IgG sequences for assembly of single-chain variable fragments (scFvs). A scFv-phage display library was constructed and 3 rounds of biopanning were performed using D-positive and D-negative red blood cells (RBCs). Positive phage clones were isolated, Sanger sequenced and, where possible, reformatted into full-length human IgGs to define specificity. The BFC aggregates from 2 anti-D donors underwent a Wright-Giemsa stain and hematological cell count. RESULTS: Of 10 BFCs, a sufficient yield of total RNA for library construction was obtained from BFCs containing cellular aggregates (n=5). Aggregate analysis showed lymphocytes were the cellular source of Ig-encoding RNA. From the 5 samples with aggregates, scFvs were assembled from amplified IgG variable regions. The library constructed from 1 of these samples resulted in the isolation of clones binding to D-positive RBCs with IGHV3 gene usage. Of the 4 reformatted IgG, 3 were anti-D and 1 had undefined specificity. DISCUSSION: BFC aggregates are a new and convenient source of Ig-encoding RNA which can be used to construct Ig gene libraries for mAb isolation and discovery via antibody phage display