Premelting base pair opening probability and drug binding constant of a daunomycin-poly d(GCAT).poly d(ATGC) complex

We calculate room temperature thermal fluctuational base pair opening probability of a daunomycin-poly d(GCAT).poly d(ATGC) complex. This system is constructed at an atomic level of detail based on x-ray analysis of a crystal structure. The base pair opening probabilities are calculated from a modified self-consistent phonon approach of anharmonic lattice dynamics theory. We find that daunomycin binding substantially enhances the thermal stability of one of the base pairs adjacent the drug because of strong hydrogen bonding between the drug and the base. The possible effect of this enhanced stability on the drug inhibition of DNA transcription and replication is discussed. We also calculate the probability of drug dissociation from the helix based on the selfconsistent calculation of the probability of the disruption of drug-base H-bonds and the unstacking probability of the drug. The calculations can be used to determine the equilibrium drug binding constant which is found to be in good agreement with observations on similar daunomycin-DNA systems

A structural study of M-DNA

In alkaline conditions, a complex called M-DNA is formed between a divalent metal ion, cobalt, nickel or zinc, and duplex DNA. The rate of formation and stability of M-DNA is dependent on many factors, including but not limited to temperature, pH, DNA sequence, and metal or DNA concentrations. It has been hypothesized that the divalent metal ions intercalate into the helix and replace the imino protons involved in the hydrogen bonding of both G-C and A-T base pairs. The complex is thought to have a double helical structure that is similar to B-DNA. The presence of the divalent metal ions and a more compact structure may contribute to M-DNA’s remarkable ability to behave as a molecular wire. Because M-DNA is so similar to B-DNA, it adheres to the same rules with regards to self-assembly. The ability of DNA to self-assemble and the electronic conduction of M-DNA are ideal properties for nanotechnology of the future. M-DNA may eventually be used to detect the presence of biologically important small molecules and DNA binding proteins that block the flow of electrons. However, before M-DNA will be widely accepted, it is necessary to obtain an accurate 3-dimensional structure by X-ray crystallography and modelling. In this work interactions between divalent cobalt, nickel or zinc with duplex DNA were studied using two different experimental methods; namely, X-ray crystallography and extended X-ray absorption fine structure spectroscopy. First, crystals of the sequence d[GA(5FU)(5FU)AA(5FU)C] and d[CG(5FU)G(5FU)GCACACG] complexed with divalent metals were grown in M-DNA favouring conditions. Both of the sequences gave crystals that provided diffraction data that were analyzed by molecular replacement using B-DNA models. Unfortunately, the quality of the diffraction was not high enough with either sequence to locate metal binding or to determine a model for M-DNA. Second, X-ray absorption spectroscopy data were analyzed for the Ni2+ K-edge of both Ni2+ M and B-DNA. Several differences between the M and the B-DNA data were noticed and some final bond distances were established

Electron paramagnetic resonance studies of spin-labelled ethidium bromide DNA interactions

Spin-Labelled Ethidium Bromide (SLEB) was prepared in order to study its interactions with natural DNA in the form of fibres . The technique of electron paramagnetic resonance was used in this thesis. Knowledge of the conformational transition pathway of natural DNA for given counterion concentration as a function of relative humidity was utilised in the study of effect DNA confomation on the binding of SLEB. To aid interpretation of the results the relevant background material was reviewed. In order to attempt to extract geometric information on binding computer ERR lineshape simulations were used. To facilitate this a microcomputer spectrometer control system was designed and implemented. This allowed spectra to be acquired in digital form and transfered to the mainframe computer. Two schemes for magnetic field control were investigated, one based on a commercial NMR magnetometer, and a superior pulsed NMR field locking magnetometer developed in this laboratory. In order to obtain lineshapes undistorted by dipolar broadening it is advantageous to use fibres with a high phosphate to drug ratio (P/D), however spectrometer sensitivity becomes a limiting factor. A review of noise in spectrometer systems is included. The use of a microwave low-noise preamplifer to reduce the system noise figure was investigated. An attempt to construct a loop-gap resonator was made and justified theoretically. A 35GHz spectrometer was constructed and a cavity designed and built to allow the humidity to be varied. The system was made compatible with the control system. Spectra recorded and simulated at this frequency should help confirm those obtained at 9GHz. The results obtained from P/D«70 fibres with a 0.5mM NaCl concentration show the SLEB is in a disordered state from 33% to 75% relative humidity. Spectral changes occur in the range 75% to 98% consistant with intercalation. In this humidity range a transition to the B-form is expected

Transcription Initiation Studies With Bacillus Subtilis Promoters Containing Curved DNA.

Many promoters contain a curved DNA component essential for high levels of transcription activity. The present work approached the study of these unusual DNA structures in a twofold manner. First, promoter binding by RNA polymerase from Bacillus subtilis and Escherichia coli was examined using a collection of promoters containing DNA curvature. Promoter binding by both RNA polymerases was governed primarily by the nucleotide sequence at the highly conserved $-$10 and $-$35 regions of the promoters. However, the presence of curved DNA, immediately upstream of the $-$35 region of the promoter, predictably increased binding to those promoters which contained curved DNA by the B. subtilis RNA polymerase. Binding by the E. coli RNA polymerase was modestly affected by DNA curvature. The second approach was to characterize the mechanism involved in transcription stimulation by this curve or intrinsically bent DNA. Generally, the proposed mechanisms for transcription initiation include enzyme conformational changes leading to strand separation. Formation of RNA polymerase-promoter complexes that entail significant conformational changes is sensitive to changes in temperature. A goal in the second part of this work was to test if curved DNA influenced a step in transcription initiation that was sensitive to temperature changes. The formation of open promoter complexes was measured using a B. subtilis phage promoter containing curved DNA upstream of the $-$35 region, the Alu156 promoter, and mutants of Alu156 in which the curved DNA sequences were displaced upstream. Open promoter complexes were measured by (1) a run-off transcription assay limited to a single round of initiation and (2) the direct detection of single stranded DNA using potassium permanganate cleavage. Promoters with properly aligned curved DNA formed open promoter complexes at lower temperatures than promoters with misaligned curved DNA. Also, curved DNA enhanced formation of open promoter complexes as measured by actual strand separation. A model describing the effect of curved DNA on open promoter complexes was proposed

The Double Helix in Motion: New Insights into Sequence-specific, Functional DNA Dynamics Using NMR Spectroscopy

DNA is a highly flexible molecule that undergoes a variety of structural transitions in response to cellular cues. Sequence-directed variations in the canonical double helix structure that retain Watson-Crick base-pairing play important roles in DNA recognition, topology, and nucleosome positioning. Here, we use NMR relaxation methods to study sequence-directed dynamics occurring at picosecond to millisecond timescales in variable size DNA duplexes. Traditionally, atomic-level spin relaxation studies of DNA dynamics have been limited to short duplexes, in which sensitivity to biologically relevant nanosecond fluctuations is often inadequate. We introduce a method for preparing residue-specific 13C/15N-labeled elongated DNA along with a strategy for establishing resonance assignments and apply it towards probing fast inter-helical bending motions induced by an adenine tract. Our results suggest the presence of elevated A-tract independent end-fraying and/or bending internal nanosecond motions, which evade detection in short constructs and that penetrate deep within the helix and gradually fade away towards its interior. By studying picosecond-nanosecond dynamics in short DNA dodecamers with variable length A-tracts, we discover that A-tracts are relatively rigid and can modulate the flexibility of their junctions in a length-dependent manner. We identify the presence of large-amplitude deoxyribose internal motions in CA/TG and CG steps placed in different sequences that likely represent rapid sugar repuckering. Moreover, by using NMR relaxation dispersion in concert with steered molecular dynamics simulations, we observe transient sequence-specific excursions away from Watson-Crick base-pairing at CA/TG and TA steps inside DNA dodecamers towards low-populated and short-lived A•T and G•C Hoogsteen base pairs. We show that their populations and lifetimes can be modulated by environmental factors like acidity, monovalent and divalent ions as well as intrinsic sequence and chemical modifications. The observation of Hoogsteen base pairs in duplexes specifically bound to transcription factors and in damaged sites implies that the DNA double helix intrinsically codes for excited state Hoogsteen base pairs as a means of expanding its structural complexity beyond Watson-Crick base-pairing. The methods presented here provide a new route for characterizing transient nucleic acid structures, which we predict will be abundant in the genome and constitute a second transient layer of the genetic code.Ph.D.Chemical BiologyUniversity of Michigan, Horace H. Rackham School of Graduate Studieshttp://deepblue.lib.umich.edu/bitstream/2027.42/89648/1/nikolove_1.pd

Structural and functional studies of AT-Rich DNA ligands and their effect on trypanosoma brucei

AT-rich sequences confer unique properties to DNA, such as high polymorphism and flexibility. The abundance of AT-rich DNA in several pathogens' genomes and the ability of specific molecules to selectively target AT base pairs have prompted studies on ligands that interact with the minor groove of high AT content DNA. Of special interest are kinetoplastid parasites, such as Trypanosoma brucei, the causative agent of sleeping sickness, which are distinguished by the presence of a very AT-rich mitochondrial DNA structure called kinetoplast. Minor groove binding ligands have offered critical information on DNA molecular recognition, providing clinically useful strategies against diseases. Thus, the binding affinity and structural characteristics of AT-rich oligonucleotides in complex with different ligands, specifically with HMG proteins and bisimidazolinium compounds, has been chosen as the object of study. The `High Mobility Group¿ (HMG) is a family of architectural proteins that bind to DNA and influence a myriad of essential cellular processes. This research work has focused in two HMG subfamilies: HMGA and HMGB. They bind to the minor groove of the DNA by means of AT-hook (HMGA) or HMG-box (HMGB) domains. HMGA1a(50-91), HMGB1 box B and HMGB1 box AB have been expressed and purified. High similar binding affinity to an AT-rich DNA sequence containing [AATAAT_ATTATT] has been found by SPR¿biosensor experiments for both proteins. A d[CCAATAATCGCGATTATTGG]2-HMGB1 box B complex was crystallized. The diffraction patterns of the crystal at 2.68 Å resolution presented well-defined spots revealing two diffraction orientations. A series of derivatives of FR60 [4-((4,5-dihydro-1H-imidazol-2-yl)amino)-N-(4-((4,5-dihydro-1Himidazol-2-yl)amino)phenyl)benzamide] have been proved to be high affinity DNA binders with a preference for AT over GC-rich DNA, showing slight selectivity towards sequences containing [AATT] versus [(AT)4] or [AATAAT_ATTATT]. Furthermore, competition assays have demonstrated that JNI18 competes with HMGA1a and HMGB1 for binding to DNA and it is able to displace the proteins from their DNA binding sites. This last interaction is of prime importance, as related proteins have been found to be essential in kinetoplastid parasites. The structure of the bis(2-aminoimidazoline) compound CDIV32 with the oligonucleotide d[AAATTT]2 partially solved at 3.10 Å resolution, displays DNA columns of stacked oligonucleotides forming apseudo-continuous helix packed in a crossed column configuration of DNA helices that are at ~90° to each other. The presence of the drug CDIV32 modulates the organization of duplexes. The crystal structure of the complex of the oligonucleotide d[AAATTT]2 with the lead compound FR60, solved at atomic resolution of 1.25 Å (PDB-ID: 5LIT) by X-ray crystallography, is constituted of stacked oligonucleotides organized as infinite continuous parallel columns, packed in a pseudo-tetragonal configuration. The structure revealed that the drug interacts with the central [AATT] region, covers the minor groove of DNA, displaces bound water and interacts with neighboring DNA molecules as a crosslinking agent. Finally, a functional analysis has been performed on the effect of different bis(2-aminoimidazolines) on T.brucei (>70% AT kDNA) to assess whether parasite DNA was a target for these compounds. By a combination of flow cytometry and imaging techniques such as fluorescence microscopy and TEM, it was demonstrated that these compounds have a clear effect on the S-phase of T. brucei cell cycle by inflicting specific damage on the kinetoplast. It can be concluded that the studied DNA binding compounds FR60 and JNI18 are powerful trypanocides that act directly on the kinetoplast DNA. As the compounds show 100% curative activity in a mouse model of T. b. rhodesiense infection, they are potentially an effective chemotherapeutic agent for the treatment of sleeping sickness.Las secuencias ricas en AT le confieren al ADN propiedades únicas como un alto polimorfismo y flexibilidad. Su abundancia en el genoma de varios patógenos y la selectividad de unión a secuencias AT que presentan ciertas moléculas, han llevado al estudio de ligandos que interactúan con el surco estrecho de DNA con alto contenido en AT. De especial interés son los parásitos kinetoplástidos, como el Trypanosoma brucei, agente causante de la enfermedad del sueño, los cuales se distinguen por la presencia de una estructura de ADN mitocondrial muy rica en AT llamada kinetoplasto. Los ligandos de unión al surco estrecho han ofrecido información primordial sobre el reconocimiento molecular del ADN, proporcionando estrategias terapéuticas útiles. Por ello, se ha elegido como objeto de estudio complejos de ADN ricos en AT con diferentes ligandos, específicamente con proteínas HMG y compuestos bisimidazolinio. Las HMG son una familia de proteínas arquitectónicas que se unen al ADN e influyen en numerosos procesos celulares esenciales. En este trabajo se han estudiado dos subfamilias de las HMG: HMGA y HMGB. Ambas se unen al surco estrecho del ADN mediante diferentes motivos de unión: AT-hook (HMGA) y HMG-box (HMGB). Se han expresado y purificado las formas HMGA1a(50-91), HMGB1 box B y HMGB1 box AB. Mediante SPR, ambas proteínas presentaron una afinidad de unión alta y similar hacia un ADN conteniendo la secuencia [AATAAT_ATTATT]. Se cristalizó el complejo d[CCAATAATCGCGATTATTGG]2- HMGB1 box B. La difracción a una resolución de 2.68 Å presentó reflexiones bien definidas que indicaban dos orientaciones preferenciales. Una serie de derivados del compuesto FR60 [4-((4,5-dihidro-1H-imidazol-2-il)amino)-N-(4-((4,5-dihidro-1H-imidazol-2-il)amino)fenil)benzamida] han demostrado ser ligandos de alta afinidad por secuencias AT con respecto a GC, mostrando cierta preferencia hacia secuencias con [AATT] comparado con [(AT)4] o [AATAAT_ATTATT]. Además, se ha demostrado que el JNI18 compite con la HMGA1a y la HMGB1 en su unión al ADN y es capaz de desplazar a dichas proteínas de sus sitios de unión al ADN. Este hecho es de especial relevancia, ya que se han encontrado proteínas relacionadas que son esenciales en parásitos kinetoplástidos. La estructura del compuesto de bis(2-aminoimidazolinio) CDIV32 con el oligonucleótido d[AAATTT]2 ha sido parcialmente resuelta a una resolución de 3.10 Å. Se encontraron columnas de oligonucleótidos apilados formando una hélice pseudo-continua, empaquetada en una configuración de columnas cruzadas perpendicularmente. La presencia del fármaco CDIV32 modula la organización de las hélices de ADN. Se ha resuelto la estructura cristalográfica del complejo d[AAATTT]2-FR60 a resolución atómica de 1.25 Å (PDB-ID: 5LIT). Se encontraron los oligonucleótidos apilados organizados en columnas infinitas y paralelas en una configuración pseudo-tetragonal. El fármaco interacciona con la región central [AATT], ocupa el surco estrecho del ADN, desplaza las moléculas de agua presentes e interactúa con moléculas de ADN vecinas como un agente entrecruzador. Finalmente, se ha realizado un análisis funcional del efecto de diferentes compuestos bis(2-aminoimidazolinio) en T. brucei (con >70% de AT en su kDNA) para evaluar si el ADN del parásito es una diana para estos compuestos. Se ha estudiado su efecto in vitro mediante una combinación decitometría de flujo y técnicas como microscopía de fluorescencia y TEM. Los resultados permitieron demostrar que estos compuestos tienen un efecto claro sobre la fase S del ciclo celular de T. brucei al dañar específicamente el kinetoplasto. Se ha podido concluir que los compuestos FR60 y JNI18 son potentes tripanocidas que actúan directamente sobre el ADN del kinetoplasto. Ya que los compuestos muestran una actividad curativa del 100% en un modelo de ratón infectado por T. b. rhodesiense, representan un agente quimioterapéutico potencialmente eficaz para el tratamiento de la enfermedad del sueño.Postprint (published version

Structure energy relationship of biological halogen bonds

2012 Summer.Includes bibliographical references.The primary goal of the studies in this thesis is to derive a set of mathematical models to describe the anisotropic atomic nature of covalent bound halogens and by extension their molecular interactions. We use a DNA Holliday junctions as a experimental model system to assay the structure energy relationship of halogen bonds (X-bonds) in a complex biological environment. The first chapter of this dissertation is reserved for a review on DNA structure and the Holliday Junction in context of other DNA conformations. The conformational isomerization of engineered Holliday junctions will be established as a means to assay the energies of bromine X-bonds both in crystal and in solution. The experimental data are then used in the development of anisotropic force fields for use in the mathematical modeling of bromine halogen bonds, serving as a foundation to model all biological halogen interactions. The DNA Holliday junction experimental system is expanded to compare and contrast halogens from fluorine to iodine. This comprehensive study is used to determine the effects of polarization on the structure-energy relationship of biological X-bonds in solid state and solution phase. The culmination of the work in this thesis, in addition to previously published studies, provides a growing set of principles to guide knowledge-based application of halogens in drug design. These principles are applied to the selection of X-bond acceptors in a protein binding pocket, optimal placement of the halogen on the lead compound, and which halogen is best suited for a particular interaction

Anomalous structure and properties of poly (dA).poly(dT). Computer simulation of the polynucleotide structure with the spine of hydration in the minor groove.

The results of the search for low-energy conformations of poly(dA).poly(dT) and of the poly(dA).poly(dT) "complex" with the spine of hydration similar to that found by Dickerson and co-workers (Kopka, M.L., Fratini, A.V., Drew, H.R. and Dickerson, R.E. (1983) J. Mol. Biol. 163, 129-146) in the minor groove of the CGCGAATTCGCG crystals are described. It is shown that the existence of such a spine in the minor groove of poly(dA).poly(dT) is energetically favourable. Moreover, the spine of hydration makes the polynucleotide conformation similar to the poly(dA).poly(dT) structure in fibers and to the conformation of the central part of CGCGAATTCGCG in crystals; it also acquires features characteristic of the structure of poly(dA).poly(dT) and DNA oligo(dA)-tracts in solution. It is shown that the existence of the TpA step in conformations characteristic of the poly(dA).poly(dT) complex with the spine of hydration is energetically unfavourable (in contrast to the ApT step) and therefore this step should result in destabilization of the spine of hydration in the DNA minor groove. Thus, it appears that the spine of hydration as described by Dickerson and co-workers is unlikely to exist in the poly d(A-T).poly d(A-T) structure. The data obtained permit us to interpret a large body of experimental facts concerning the unusual structure and properties of poly(dA).poly(dT) and oligo(dA)-tracts in DNA both in fibers and in solution. The results provide evidence of the existence of the minor groove spine of hydration both in fibers and in solution on A/T tracts of DNA which do not contain the TpA step. The spine plays an active role in the formation of the anomalous conformation of these tracts