Ferreira, Débora

Rodrigues, L. R.

Sousa, Diana Zita Machado

Sousa, Diana Andrade

Universidade do Minho: RepositoriUM

306  Microbiotec’17 – Book of Abstracts Health Microbiology and Biotechnology P-194 - IN SILICO SELECTION OF AN SSDNA APTAMER AGAINST HER2-POSITIVE BREAST CANCER CELLS USING COMPUTATIONAL DOCKING SIMULATION  Diana Sousa1; Débora Ferreira1; Ligia Rodrigues1  1 - Centre of Biological Engineering, University of Minho  Background  Human epidermal growth factor receptor type 2 (HER2/ErbB2) is a breast cancer associated protein overexpressed in 20% of breast cancers, being involved in cell growth regulation, survival and differentiation.1,2 The location of HER2 on the cell surface has contributed to its appeal as a tumour-targeted therapy.3 Aptamers, generated from Systematic Evolution of Ligands by EXponential Enrichment (SELEX), emerged as potential tool for application in target cancer therapy due to their three-dimensional structures that recognize cell surface receptors.4 Method  In this study, HER2-aptamers were screened and identified using SELEX technology. After cloning and sequencing, aptamers were modelled through m-fold software and posteriorly, the docking simulation was predicted using ZDOCK server.5,6 These in silico predictions measured the aptamer-HER2 interactions through a combination of shape complementarity and statistical potential terms for scoring. Results & Conclusions  Based on the interaction score, a candidate ssDNA-aptamer (HER2-31; 5´- CACGTGCAGGGTGGATAGCAATCTATCCGGTCCCACTGTTCGGTGGTCGC -3’) was selected. Targeted-specificity of the selected HER2-31 was validated through cytometry and fluorescence microscopy assays in HER2-positve breast cancer cells. Our results indicate that SELEX technology is an efficient method to screen specific protein-bound ssDNA, and HER2-31 could be used as an agent in HER2-based diagnosis and targeted therapy. Also, the results provide valuable guidelines for the application of docking simulations for the prediction of aptamer-ligand structures, as well as for the design of novel features of ligand-aptamer complexes.  References & Acknowledgments  1.           Iqbal, N. & Iqbal, N. Human Epidermal Growth Factor Receptor 2 (HER2) in Cancers: Overexpression and Therapeutic Implications. Mol. Biol. Int. 2014, 852748 (2014). 2.           Mendes, D. et al. The benefit of HER2-targeted therapies on overall survival of patients with metastatic HER2-positive breast cancer - a systematic review. Breast Cancer Res. 17, 140 (2015). 3.           English, D. P., Roque, D. M. & Santin, A. D. HER2 expression beyond breast cancer: therapeutic implications for gynecologic malignancies. Mol. Diagn. Ther. 17, 85–99 (2013). 4.           Dupont, D. M., Larsen, N., Jensen, J. K., Andreasen, P. A. & Kjems, J. Characterisation of aptamer-target interactions by branched selection and high-throughput sequencing of SELEX pools. Nucleic Acids Res. 43, e139 (2015). 5.           Catherine, A. T., Shishido, S. N., Robbins-Welty, G. A. & Diegelman-Parente, A. Rational design of a structure-switching DNA aptamer for potassium ions. FEBS Open Bio 4, 788–95 (2014). 6.           Pierce, B. G. et al. ZDOCK server: interactive docking prediction of protein–protein complexes and symmetric multimers. 1–3 (2014). doi:10.1093/bioinformatics/btu097   In silico selection of an ssDNA aptamer against HER2-positive breast cancer cells using computational docking simulation  Keywords: aptamers, SELEX, breast cancer, HER 2   

In silico selection of an ssDNA aptamer against HER2-positive breast cancer cells using computational docking simulation

http://repositorium.sdum.uminho.pt/bitstream/1822/51584/1/document_47416_1.pdf

In silico selection of an ssDNA aptamer against HER2-positive breast cancer cells using computational docking simulation

Abstract

Similar works

Full text

Available Versions

Universidade do Minho: RepositoriUM

Universidade do Minho: RepositoriUM