Poster apresentado no XIV Congresso Nacional de Bioquímica, Vilamoura, Portugal, 2004

Afonso, P.

Almeida, M. J.

Universidade do Minho: RepositoriUM

Microbiological Analysis of Portugal   Northern Coastal Beach Sands Afonso, P. and Almeida, M. J.    Universidade do Minho - Departamento de Biologia - Campus de Gualtar, 4710-057 Braga, Portugal The Blue Flag award as a symbol of environmental quality conferred to beaches, has been the sole criterion used to validate the quality of a seaside beach. However, the microbiological analysis of the sand, which can represent a potential risk to human health, is not being included as a quality parameter.  The main objective of this work was to evaluate the microbiological flora, mainly the yeast flora of clinical interest, in order to contribute for a more accurate evaluation of the Portuguese beaches.  Microbiological surveys were carried out in two northern public bathing beaches of Portugal, Salgueiros and Labruje, both in Winter and Summer. The 58 sand samples were collected from five different sites, at three depths (0; 0,5; 1 m), along the sea coast of each beach.  Only the Salgueiros beach exhibited the Blue Flag award. Universidade do Minho  Escola de Ciências  Departamento de Biologia Introduction Methods Beach  Labruje   Salgueiros  Season Depth  (meters)  Dry zone   Wet zone   Dry zone   Wet zone        Winter    0 E1 E3 E5 E2 E4 E1 E2 E4 E3 E5  Cryptococcus laurentii   Metschnikowia zobellii    *    Cryptococcus laurentii  Rhodotorula graminis   Rhodotorula sloofiae  *   Cryptococcus laurentii    *  Debaryomyces hansenii   0.5  Metschnikowia zobellii   Candida  sorbophila    Torulaspora delbrueckii  Trichosporon domesticum    1  Cryptococcus sp.  *   Debaryomyces hansenii   *  Sample collection: Samples of 30g of sand from each site and depth were collected in sterile Falcon tubes and kept at 4ºC until microbiological analysis. Sample analysis: 0,4g of sand and 100µl of a sand suspension (9ml of sterilized water and 3g of sand) were separately plated onto YEPDA, YMA, YEPDA 10% NaCl and YEPDA 0,05% chloramphenicol. The number of colony forming units was calculated from decimal dilutions of each sand suspension, spread on YEPDA plates. Gram staining allowed an estimate of the relative percentage of Gram+ and Gram- bacteria. Only yeasts were isolated regarding further studies.  Yeasts characterization and identification: Yeast characterization included morphological, physiological and biochemical tests. Molecular identification was performed by PCR-RFLP analysis (endonucleases CfoI, HaeIII and HinfI) of the intergenic transcribed spacers (ITS) of the rDNA and the results were compared with available databases. Whenever PCR-RFLP did not allow yeast identification to species level, it was determined by sequencing the D1/D2 domain of the large-subunit (26S) rDNA using primers F63 (5’- GCATATCAATAAGCGGAGGAAAAG) and LR3 (5’- GGTCCGTGTTTCAAGACGG). Results and discussion  Fig. 4 - Agarose gel electrophoresis of the PCR amplification products, using primers ITS1 and ITS4, and of the fragments produced by  CfoI, HaeIII and HinfI digestion.  M - DNA Molecular weight marker (100 bp ladder);  1, 2 - Cryptococcus laurentii;  3, 4 – Metschnikowia zobellii; 5 - Candida sorbophila. Final Remarks In what concerns to the results obtained up to now, we may point out: Yeasts identification: Yeasts identification was based on morphological, physiological, biochemical tests and PCR-RFLP analysis. Whenever identification to species level was not possible once some data did not match any described profile, D1/D2 domain of the large-subunit (26S) rDNA sequencing was performed. Table 1 summarises the results obtained by the combination of the different methods.  • During winter, in both studied beaches, the Gram– bacteria  were prevalent, even when each depth was evaluated.  • In spite of the geographic neighbouring of both beaches, they presented a distinctive and unique yeast flora.   • The size of the PCR products and the restriction analyses with the three restriction endonucleases (CfoI, HaeIII, HinfI ) yielded a specific pattern for each species, allowing isolates screening and grouping.   Sample analysis: The different groups of microorganisms were  analysed and yeasts were isolated regarding further characterization and identification. Bacteria analysis: After submitting the bacteria to Gram staining we observed a dominance of Gram- bacteria in almost all sand samples (Fig. 2).  Yeasts characterization: In order to search for the existence of urease enzymes, the traditional physiological and biochemical test of urea hydrolysis was performed. Urease positive yeasts turned the colour of the medium into bright pink due to urea hydrolysis. The percentage of urease positive and negative yeasts was calculated (Fig.3). The present results concern only the winter of 2003  Fig. 1 – Direct sand sampled on YEPDA 0,0010,0020,0030,00Labruje SalgueirosGram +Gram -Yeasts identification: The 102 isolates were screened and grouped according to the results of the PCR-RFLP analysis (Fig. 4). The molecular weights of the amplified and digested products were determined using the Lab Image program and compared with available databases for species identification. Table 1 – Spatial distribution of the yeast flora present in each studied beach in winter 2003 Fig. 2 – Total number of bacteria CFU/g sand present in the two beaches Fig.3 – Percentage of urease positive and negative yeasts present in the sand of the two beaches 0255075100Labruje Salgueiros% Yeastsurease -urease +PCR amplification products    1             2                            M           3             4              5            bp   1000         500 Restriction analysis    1     2    3    4    5    M     1     2     3    4    5    M      1     2    3    4    5    M    bp          500     300     200        bp       500     300     200            bp     500     300     200 * yeast groups for which identification is in progress CFU/g x 106 • A total of nine yeast species belonging to seven different genera was identified.  • Only one yeast species (Cryptococcus laurentii) was common to the two beaches.  • In what concerns to yeast flora of medical interest, only the genera Cryptococcus was present.  • The data obtained could be a reference point for further studies.    ACKNOWLEDGMENTS   We thank to A. Correia for her useful contributions and suggestions  

Microbiological analysis of Portugal northern coastal beach sands

http://repositorium.sdum.uminho.pt/bitstream/1822/2338/3/Poster_Congresso.pdf

Microbiological analysis of Portugal northern coastal beach sands

Abstract

Similar works

Full text

Available Versions

Universidade do Minho: RepositoriUM

Universidade do Minho: RepositoriUM