Isolated sulfite oxidase deficiency is a rare autosomal recessive inborn error of sulfur metabolism. Clinical features generally include devastating neurologic dysfunction, ectopia lentis, and increased urinary excretion of sulfite, thiosulfate, an

Agatep, Ronald

Greenberg, Cheryl R

Mhanni, Aizeddin A

Prasad, Chitra

Sisk, Reena Ray

Spriggs, Elizabeth L

English

Scholarship@Western

Western University Scholarship@Western Paediatrics Publications Paediatrics Department 12-1-2020 Isolated sulfite oxidase deficiency: a founder mutation. Aizeddin A Mhanni Cheryl R Greenberg Elizabeth L Spriggs Ronald Agatep Reena Ray Sisk See next page for additional authors Follow this and additional works at: https://ir.lib.uwo.ca/paedpub  Part of the Pediatrics Commons Citation of this paper: Mhanni, Aizeddin A; Greenberg, Cheryl R; Spriggs, Elizabeth L; Agatep, Ronald; Sisk, Reena Ray; and Prasad, Chitra, "Isolated sulfite oxidase deficiency: a founder mutation." (2020). Paediatrics Publications. 556. https://ir.lib.uwo.ca/paedpub/556 Authors Aizeddin A Mhanni, Cheryl R Greenberg, Elizabeth L Spriggs, Ronald Agatep, Reena Ray Sisk, and Chitra Prasad This article is available at Scholarship@Western: https://ir.lib.uwo.ca/paedpub/556 Isolated sulfite oxidase deficiency:a founder mutationAizeddin A. Mhanni,1 Cheryl R. Greenberg,1,2 Elizabeth L. Spriggs,1,2Ronald Agatep,2 Reena Ray Sisk,3 and Chitra Prasad41Department of Pediatrics and Child Health, 2Department of Biochemistry andMedical Genetics, University ofManitoba,Winnipeg, Manitoba R3A 1S1, Canada; 3Saskatoon Health Authority, Saskatoon S7K 0M7, Canada;4London Health Sciences Centre, Western University, London, Ontario N6A 5A5, CanadaAbstract Isolated sulfite oxidase deficiency is a rare autosomal recessive inborn error of sul-fur metabolism. Clinical features generally include devastating neurologic dysfunction,ectopia lentis, and increased urinary excretion of sulfite, thiosulfate, and S-sulfocysteine.Missed diagnosis is not unusual because of variability in the sensitivity of the urinary sulfiteand thiosulfate screening test. We present clinical, biochemical, and molecular data on twounrelated patients with isolated sulfite oxidase deficiency. The two patients belong to anIndigenous genetic isolate in Manitoba, Canada. Both patients (one male and one female,both now deceased) developed neonatal seizures and demonstrated progressive neurode-velopmental delay. Based on increased urinary excretion of sulfite, thiosulfate, and S-sulfo-cysteine and normal serum uric acid levels, sulfite oxidase deficiency was suspected. Bothpatients have a homozygous 4-bp deletion, 1347–1350delTTGT in the sulfite oxidase gene(SUOX), predicting a premature termination of the sulfite oxidase protein leading to ab-sence of the carboxy-terminal third portion of the protein. This domain contains most ofthe contact sites essential for enzyme dimerization. This deletionmutation resulted in sulfiteoxidase deficiency with early-onset severe clinical phenotype.CASE PRESENTATIONThe clinical and biochemical data on the two patients are presented in Tables 1 and 2,respectively.TECHNICAL ANALYSISGenomic DNA was isolated from cultured fibroblasts and/or blood samples, and the geneencoding SUOX was amplified by polymerase chain reaction (PCR) using standard condi-tions. PCR primers spanning the entire coding region (CCTCAAGGATCTGCATTCAGGCCand AAGGGGTGGAGGTGGCTCCTTTCC) were included at a concentration of 1 µmolar,and the reaction was cycled for 30 sec at 55°, for 5 min at 68°, and for 30 sec at 95° for a totalof 35 cycles. The entire reaction mixture was run on an agarose gel and the band at ∼2.4 kb,corresponding to the sulfite oxidase gene with its single intron, was extracted from the geland sequenced in both the forward and reverse directions. AutomatedDNA sequencing wasperformed at the Duke University Comprehensive Cancer Center facility using aPerkinElmer/ABI 377 DNA Sequencer and Big Dye sequencing chemistry. Numbering of nu-cleotides is based on the cDNA sequence, with the A of the ATG initiator methionine codonCorresponding author:amhanni@hsc.mb.ca© 2020Mhanni et al. This article isdistributed under the terms ofthe Creative CommonsAttribution-NonCommercialLicense, which permits reuse andredistribution, except forcommercial purposes, providedthat the original author andsource are credited.Ontology terms: increasedurinary sulfite; increased urinarythiosulfatePublished by Cold Spring HarborLaboratory Pressdoi:10.1101/mcs.a005900| RAPID COMMUNICATIONC O L D S P R I N G H A R B O RMolecular Case StudiesCite this article as Mhanni et al. 2020 Cold Spring Harb Mol Case Stud 6: a005900 1 of 4 Cold Spring Harbor Laboratory Press on July 13, 2021 - Published by molecularcasestudies.cshlp.orgDownloaded from denoted nucleotide +1. Numbering of the amino acids is also from the initiator methionine,which is the first amino acid in the 22-residue leader sequence of sulfite oxidase.VARIANT INTERPRETATIONBoth patients have a homozygous 4-bp deletion, 1347–1350delTTGT in the sulfite oxidasegene (SUOX), predicting a premature termination of the sulfite oxidase protein leading toabsence of the carboxy-terminal third portion of the protein. This domain contains mostof the contact sites essential for enzyme dimerization. The parents are heterozygous forthis variant. This novel variant in SUOX likely is a founder mutation, given its presence intwo unrelated Indigenous children from the same genetic isolate (Table 3).Isolated sulfite oxidase deficiency (MIM 272300) is an autosomal recessive disordercaused by mutations in the sulfite oxidase gene (SUOX), GenBank accession numberAY056018. The gene is located on Chromosome 12, in the region of 12q13.2, and the cod-ing sequence contains a single intron. The gene product, sulfite oxidase, is a molybdohemo-protein comprised of 466 amino acids. It is synthesized with a 22-residue leader sequencethat directs it to the mitochondrial intermembrane space. The mature protein lacks this pre-sequence. The native enzyme is a dimer of identical subunits, each of which contains threedomains—the amino-terminal heme domain, the central molybdenum domain, and a car-boxy-terminal domain with key residues at the dimer interface (Johnson and Rajagopalan1976; Kisker et al. 1997). The enzyme catalyzes the oxidation of sulfite to sulfate, the terminalreaction in the degradation of sulfur-containing amino acids, and transfers the electrons de-rived from substrate oxidation to cytochrome c on the inner mitochondrial membrane.Sulfite oxidase deficiency is classically characterized by severe neurological symptomsincluding seizures, often refractory to anticonvulsant medications, and rapidly progressingTable 1. Clinical findingsPatientAge atpresentation Sex SymptomsLensdislocation Family historyEthnicbackgroundCurrentstatus1 First week F Intractable seizures, severedevelopmental delay, spasticquadriplegiaNot assessed Negative Indigenous Deceased at9 yr2 5 d M Lethargy, hypotonia, severedevelopmental delay,intractable seizuresNot assessed Possible affectedolder sibling basedon historyIndigenous Deceased at15 moTable 2. Biochemical findingsAnalyte(normalrange)Urine S-sulfo-cysteine (<25µmol/mmolCr)Urine sulfite(not detected)Plasmacystine(23–49µmol/L)Serum uricacid (130–330 µmol/L)Xanthinehypoxanthine Cranial MRIEnzymeactivity(liver)(7–28 µ/g)MoleculardiagnosisPatient 1 Small peak 80–400 mg/L 5 162 Normal Agenesis ofcorpuscallosum0 1347-1350delTTGTPatient 2 131 40 mg/L 4 187 Normal GiantcisternamagnaNot done 1347-1350delTTGTSulfite oxidase deficiencyC O L D S P R I N G H A R B O RMolecular Case StudiesMhanni et al. 2020 Cold Spring Harb Mol Case Stud 6: a005900 2 of 4 Cold Spring Harbor Laboratory Press on July 13, 2021 - Published by molecularcasestudies.cshlp.orgDownloaded from to an encephalopathic state. A significant proportion of patients develop complete or partialectopia lentis. Althoughmilder cases have been described, in the classic presentation, deathoccurs at an early age, and none of the treatments tested to date improved the clinical out-come (Johnson and Duran 2001). The preliminary diagnosis is made by elevated urinary sul-fites, increased excretion of thiosulfate, increase in S-sulfocysteine, and normal serum uricacid, xanthine, and hypoxanthine. Confirmatory diagnosis is made by measuring sulfite ox-idase activity in liver or fibroblasts or identifying a disease-causing mutation in SUOX. Todate there have been 21 missense/nonsense mutations, seven small deletions, and onesmall insertion in SUOX reported in individuals with isolated sulfite oxidase deficiency(HGMD). The mutation identified here resulted in severe sulfite oxidase deficiency with earlyonset and severe clinical manifestations.SUMMARYIt is important to consider isolated sulfite oxidase deficiency/molybdenum cofactor defi-ciency particularly when dealing with severe seizures and developmental delay in infancy.Screening of fresh urine for sulfites is a simple test but has false positives and false negatives.Urine for thiosulfate can be falsely positive with sulfur containing antibiotics and some anti-convulsants. Urine screening for S-sulfocysteine is more reliable. Uric acid is normal in isolat-ed sulfite oxidase deficiency as compared to molybdenum cofactor deficiency, in which it isusually low. Cranial MRI and EEG are usually abnormal although not diagnostic. The muta-tion described here of a 4-bp deletion 1347–1350delTTGT in SUOX, in two unrelatedIndigenous patients predicts a premature termination of the sulfite oxidase protein.Carrier screening for this deletionmutation will be offered to the patients’ extended families.ADDITIONAL INFORMATIONData Deposition and AccessThe variant has been submitted to ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/) and canbe found under accession number SCV001450523.Ethics StatementVerbal consent for publication from the families was obtained. We did not require ResearchEthics Board approval as the molecular testing reported in this manuscript was done as partof standard clinical care.AcknowledgmentsWe thank Dr. K. Rajagopalan and Dr. J.L. Johnson from the Department of Biochemistry,Duke University Medical Center for the initial molecular studies. We thank the patientsand their families for their cooperation.Table 3. Genomic findingsDisease Gene Inheritance HGVS cDNA NM Mutation ProteinVariantinterpretationSulfite oxidasedeficiencySUOX AutosomalrecessiveNC_000012.11:g.56398694_56398697delTTGTNM_000456.2:c.1521_1524delTTGTc.1521_1524delTTGT p.C508Rfs∗109 PathogenicCompeting Interest StatementThe authors have declared nocompeting interest.RefereesAndreas SchulzeAnonymousReceived October 12, 2020;accepted in revised formNovember 5, 2020.Sulfite oxidase deficiencyC O L D S P R I N G H A R B O RMolecular Case StudiesMhanni et al. 2020 Cold Spring Harb Mol Case Stud 6: a005900 3 of 4 Cold Spring Harbor Laboratory Press on July 13, 2021 - Published by molecularcasestudies.cshlp.orgDownloaded from Author ContributionsA.A.M., C.R.G., and C.P. oversaw patient care, data collection, data analysis, genetic inter-pretation, and writing the original draft preparation. R.R.S. assisted with the molecular anal-ysis. E.L.S. and R.A. verified the accuracy of the molecular nomenclature and helped submitthe variant to ClinVar. All coauthors read and approved the manuscript.FundingWork at Duke University Medical Center was supported by a National Institutes of Health(NIH) Grant 61444283.REFERENCESKisker C, Schindelin H, Pacheco A, Wehbi WA, Garrett RM, Rajagopalan KV, Enemark JH, Rees DC. 1997.Molecular basis of sulfite oxidase deficiency from the structure of sulfite oxidase. Cell 91: 973–983.doi:10.1016/S0092-8674(00)80488-2Johnson JL, Duran M. 2001. Molybdenum cofactor deficiency and isolated sulfite oxidase deficiency. In Themetabolic and molecular bases of inherited disease, 8th ed. (ed. Scriver CR, Beaudet AL, Sly WS, Valle D),pp. 3163–3177. McGraw-Hill, New York.Johnson JL, Rajagopalan KV. 1976. Human sulfite oxidase deficiency: characterization of the molecular defectin a multicomponent system. J Clin Invest 58: 551–556. doi:10.1172/JCI108500Sulfite oxidase deficiencyC O L D S P R I N G H A R B O RMolecular Case StudiesMhanni et al. 2020 Cold Spring Harb Mol Case Stud 6: a005900 4 of 4 Cold Spring Harbor Laboratory Press on July 13, 2021 - Published by molecularcasestudies.cshlp.orgDownloaded from  10.1101/mcs.a005900Access the most recent version at doi: a005900 6:2020, Cold Spring Harb Mol Case Stud   Aizeddin A. Mhanni, Cheryl R. Greenberg, Elizabeth L. Spriggs, et al.   Isolated sulfite oxidase deficiency: a founder mutation  Licensefor commercial purposes, provided that the original author and source are credited.Attribution-NonCommercial License, which permits reuse and redistribution, except This article is distributed under the terms of the Creative CommonsServiceEmail Alerting   click here.top right corner of the article or Receive free email alerts when new articles cite this article - sign up in the box at the© 2020 Mhanni et al.; Published by Cold Spring Harbor Laboratory Press Cold Spring Harbor Laboratory Press on July 13, 2021 - Published by molecularcasestudies.cshlp.orgDownloaded from 

Isolated sulfite oxidase deficiency: a founder mutation.

https://ir.lib.uwo.ca/cgi/viewcontent.cgi?article=1562&context=paedpub

Isolated sulfite oxidase deficiency: a founder mutation.

Abstract

Similar works

Full text

Available Versions

Scholarship@Western