Gaucher Disease (GD) type 3 is a neurological form of a multisystemic autosomal recessive disorder belonging to the group of lysosomal storage diseases. Causal mutations in the glucocerebrosidase 1 (GBA1) commonly lead to abnormal protein and GD, heterozygosity is a genetic risk factor for Parkinson's disease. This work describes the use of a non-integrative approach using Sendai Virus delivery to establish induced Pluripotent Stem Cells (iPSCs) from fibroblasts from a GD type 3 patient. Differentiation of iPSCs can be employed to generate a variety of complex cell types with a high degree of genetic complexity that would otherwise be unattainable.Funding Agency

Portuguese Foundation for Science and Technology
PTDC/BIM-MEC/4762/2014info:eu-repo/semantics/publishedVersio

Amaral, Olga

Bragança, José

Duarte, Ana Joana

Moreira, Luciana

Ribeiro, Diogo

Santos, Renato

Stem Cell Research

English

The authors thank Hildeberto Correia (Department of Human Genetics in Lisbon), for the karyotype analysis; José Ferrão (Department of Human Genetics in Lisbon), for the STR analysis; the collaboration of the central core services of Department of Human Genetics in Lisbon is acknowledge as well as Meghan Quint for assistance with English language.Gaucher Disease (GD) type 3 is a neurological form of a multisystemic autosomal recessive disorder belonging to the group of lysosomal storage diseases. Causal mutations in the glucocerebrosidase 1 (GBA1) commonly lead to abnormal protein and GD, heterozygosity is a genetic risk factor for Parkinson's disease. This work describes the use of a non-integrative approach using Sendai Virus delivery to establish induced Pluripotent Stem Cells (iPSCs) from fibroblasts from a GD type 3 patient. Differentiation of iPSCs can be employed to generate a variety of complex cell types with a high degree of genetic complexity that would otherwise be unattainable.This work was carried out at the Department of Human Genetics of INSA; financial support was received exclusively from the Portuguese Foundation of Science and Technology(FCT) project PTDC/BIM-MEC/4762/2014 (PI-O.A.) and R.S. is the recipient of an FCT Grant from project PTDC/BIM-MEC/4762/2014 (MCTES).info:eu-repo/semantics/publishedVersio

Scientific Repository of the National Health Institute Doutor Ricardo Jorge

Induced pluripotent stem cell line (INSAi001-A) from a Gaucher disease type 3 patient compound heterozygote for mutations in the GBA1 gene

Universidade do Algarve

Repositório Científico do Instituto Nacional de Saúde

Contents lists available at ScienceDirectStem Cell Researchjournal homepage: www.elsevier.com/locate/scrLab Resource: Single Cell LinesInduced pluripotent stem cell line (INSAi001-A) from a Gaucher disease type3 patient compound heterozygote for mutations in the GBA1 geneAna Joana Duartea,b,d, Diogo Ribeiroa,c,d, Renato Santosa, Luciana Moreiraa, José Bragançab,Olga Amarala,d,⁎a Departamento de Genética Humana, Unidade de Investigação e Desenvolvimento, Instituto Nacional de Saúde Dr Ricardo Jorge (INSA, IP), Rua Alexandre Herculano321, 4000-055 Porto, PortugalbUniversidade do Algarve, Campus Gambelas, Faro, Portugalc ICBAS, University of Porto, 4099-002 Porto, Portugald CECA, ICETA, University of Porto, 4099-002 Porto, PortugalA R T I C L E I N F OKeywords:Lysosomal glucocerebrosidaseInduced pluripotent stem cells (iPSCs)Cell modelsDisease modellingSendai virusFeeder-free cultureNon-integrative vectorGaucher type 3A B S T R A C TGaucher Disease (GD) type 3 is a neurological form of a multisystemic autosomal recessive disorder belonging tothe group of lysosomal storage diseases. Causal mutations in the glucocerebrosidase 1 (GBA1) commonly lead toabnormal protein and GD, heterozygosity is a genetic risk factor for Parkinson's disease. This work describes theuse of a non-integrative approach using Sendai Virus delivery to establish induced Pluripotent Stem Cells (iPSCs)from fibroblasts from a GD type 3 patient. Differentiation of iPSCs can be employed to generate a variety ofcomplex cell types with a high degree of genetic complexity that would otherwise be unattainable.Resource tableUnique stem cell line i-dentifierINSAi001-AAlternative name(s) ofstem cell lineGD3-1Institution INSAContact information ofdistributorOlga AmaralType of cell line Induced pluripotent stem cell line (iPSC)Origin Human (Istituto "Giannina Gaslini" Biobank)Additional origin info Age: 27 yearsSex: maleEthnicity if known: unknownCell Source Skin fibroblastsClonality ClonalMethod of reprogram-mingCytoTune™-iPS 2.0 SendaiReprogramming KitGenetic Modification YesType of Modification FamilialAssociated disease Gaucher DiseaseGene/locus GBA1 gene (Gene ID: 2629)/locus 1q22; Mutations incompound heterozygosity: p.L444P (rs421016) andp.F213I (rs381737)Method of modification Not applicableName of transgene or r-esistanceNot applicableInducible/constitutive s-ystemNot applicableDate archived/stock da-te2019/06/25Cell line repository/ba-nkThe cell line has not been deposited in a stem cell bank orrepository but is physically cryopreserved at INSA's facil-ities in CSPGF in Porto, Portugal.Ethical approval Original fibroblast line was obtained from a non-com-mercial provider, Gaslini Institute Biobank under GeneticBiobank Guidelines, Telethon - SIGU, Analysis 4/5, 2003.Italian Data Protection Authority (Garante Privacy),General Authorisation for the processing of genetic datano. 8/2016.1. Resource utilityLysosomal Storage Diseases (LSDs) may affect hard to reach cells,such as cardiac cells and neurons, which require invasive procedures toaccess the disease-target-tissue. The present work constitutes a firststage towards the final goal of differentiating iPSCs to generate specifichttps://doi.org/10.1016/j.scr.2019.101595Received 14 August 2019; Received in revised form 15 September 2019; Accepted 19 September 2019⁎ Corresponding author at: Department of Genetics, Unit of Research & Development, 4000 Porto, Portugal.E-mail addresses: ana.duarte@insa.min-saude.pt (A.J. Duarte), diogo.ribeiro@insa.min-saude.pt (D. Ribeiro), renato.santos@insa.min-saude.pt (R. Santos),luciana.moreira@insa.min-saude.pt (L. Moreira), jebraganca@ualg.pt (J. Bragança), olga.amaral@insa.min-saude.pt (O. Amaral).Stem Cell Research 41 (2019) 101595Available online 18 October 20191873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).Tcell types to aid model pathogenesis and testing of potential ther-apeutics. It represents a useful tool for optimization of therapeuticprotocols and identification of key factors regulating pathways in organinvolvement.2. Resource detailsThis work focuses on the development of iPSCs from fibroblastsusing non-integrative approaches in a cell line of one of the mostcommon sphingolipidoses, Gaucher disease (GD). GD is a LSD usuallycaused by mutations in the glucocerebrosidase 1 (GBA1, gene ID:2629),which lead to defective glucocerebrosidase (GlcCerase, EC 3.2.1.45).Clinically, GD encompasses a continuum of clinical findings with mul-tisystemic involvement, which for diagnosis purposes is divided in threemain categories. This work used type 3 GD fibroblasts (ORPHA:77,261,OMIM:231,000). GD type 3, with late onset neurological involvement,shares clinical features of type 1 and type 2. Over the years, geneticanalyses of Parkinson Disease (PD) patients have demonstrated thatGBA1 missense mutations constitute a relatively common risk factor fordeveloping PD. The continuum of clinical symptoms of GD now en-compasses a wide variety of neurologic symptoms in addition to themultisystemic features.The original manuscript regarding this cell line had a concomitantreport of two patients with similar GBA1 genotypes but different clin-ical forms. In such cases, it is particularly difficult to evaluate howmodifying factors can contribute to the different clinical disease ex-pression. The patient whose cells were used for generating INSAi001-Awas classified as type 3, while a younger patient, with similar genotype,was type 1 [Filocamo et al., 2002]. Such divergences in symptoms andclassifications make the use of iPSCs particular interesting for model-ling and pathogenesis studies. As stated in the original paper, the type 3patient was diagnosed at age five and splenectomyzed at age ten, re-gardless of enzyme therapy he later developed untreatable epilepsy[Filocamo et al., 2002]. Interestingly, both mutations exist as pseudo-gene sequence and they both exist in patients of Japanese origin Idaet al., 1997.Differentiation of iPSCs, INSAi001-A, can generate a variety ofcomplex cell types with a high degree of genetic complexity that wouldotherwise be unattainable and might help understand the pathogenesisof GD in such cases. An iPS cell line, INSAi001-A, was successfullygenerated from skin fibroblasts from a compound heterozygous patient.All results are summarized in Fig. 1. The fibroblasts were repro-grammed by co-expressing Yamanaka's factors, OCT3/4, SOX2, KLF4,and cMYC through the integration-free Sendai virus gene-deliverymethod on a feeder-free system with vitronectin (Fig. 1A). TheINSAi001-A cell line, showed endogenous expression of the plur-ipotency markers by positive immunofluorescence staining for NANOG,SOX2, OCT4 and TRA-1–60 (Fig. 1B1-4) further quantitative analysisalso showed elevated OCT4 by RT-qPCR (Fig. 1C). The resulting iPSCsINSAi001-A had a normal karyotype (Fig. 1D) and retained the GD-causing GBA1 mutations (Fig. 1E). Differentiation potential can be seenin Fig. 1F where formation potential of the three germ layers is shownby positive Immunofluorescence staining for mesoderm (Brachyury),endoderm (SOX17) and ectoderm (Otx2). The use of Sendai Virus (SeV)vectors under feeder free conditions proved to be effective in producingiPSCs that maintain the original genetic characteristics of the donorfibroblasts, as far as the extent of the examination as shown by thecausal mutations, gene and STR analysis.3. Materials and methods3.1. Biological sampleThe skin fibroblast cell line from GD-3 patient was obtained fromInstituto Giannina Gaslini Bioresource Bank in Geneva, Italy in com-pliance with the ethical recommendations issued by the Oviedoagreement of 1997 and the International Declaration on Human GeneticData of 2003 Filocamo et al., 2014. The GD cell line used was from atype 3 patient who bears a compound heterozygous genotype withp.L444P (rs421016) and p.F213I (rs381737).3.2. Fibroblast cultureCells were maintained in DMEM(1x) + GlutaMAX™ medium(Gibco™) supplemented with 10% foetal bovine serum in a cell in-cubator.3.3. Reprogramming of fibroblasts to iPSCsCellular reprograming of fibroblasts to iPSCs was carried out using anon-integrative approach. SeV reprogramming was carried out suc-cessfully on skin fibroblasts using CytoTune™-iPS 2.0 SendaiReprogramming Kit (Invitrogen™). As reprogramming matrixVitronectin (VTNeN from Gibco™) was used. By the 10th passage SeVwas no longer detected by PCR indicating that the experiment had beensuccessful and the iPSCs were free of viral footprint. Characterisationand validation is shown in Fig. 1 and Table 1.3.4. Cell culture and passageCells were cultured on 60 mm plates coated with 1/100 Vitronectin(VTNeN) Recombinant Human Protein Truncated diluted in 1X DPBS.Incubation was at 37°C with 5% CO2 in a Refurbished Binder CB 150Air-Jacketed CO2 Incubator. Once high confluency is reached, themedium is removed, cells are washed with 1 mL of 1X DPBS and treatedwith 1 mL of 0,5 mM EDTA solution, after 4 min of incubation at roomtemperature, EDTA is removed. Cell passage is carried out by re-suspension in Gibco™ StemFlex™ Medium with 1% LonzaBioWhittaker™ PEN-STREP 5000 U Penicilin/mL and 10% Gibco™StemFlex™ Suplement (10X); 50 µL of cell suspension are added to newmatrix treated dishes in a 2 mL volume of medium.3.5. Pluripotency characterisationAs determined by real-time quantitative analysis (Fig. 1C), expres-sion of the pluripotency gene OCT4 was upregulated in iPSCs comparedto the patient fibroblasts. As seen in Fig. 1B.1–4 qualitative analysis byimmunofluorescence with NANOG, SOX2, OCT4 and TRA-1–60 anti-bodies (indicated in Table 2), showed positive staining for all plur-ipotency markers confirming pluripotent status.3.6. Genetic characterisationGenotype was established in fibroblasts and in iPSCs and the mu-tations confirmed (Fig. 1E). See Table 2 for primers used. PCR productswere purified with ExoSAP™-IT (Applied Biosystems™), for Sanger se-quencing BigDye®Terminator v3.1 (Applied Biosystems™) was used.STR analysis used the AmpFeSTR® Identifier® (Applied Biosystems™).Karyotyping was performed on G-banded metaphase chromosomesusing standard procedures and at least five metaphases were examinedper sample. As seen in Fig. 1D, the Karyotype was normal (46, XY).Quantitative real time polymerase chain reaction (qRT-PCR) was car-ried out on RNA isolated using TRIzol Reagent (Ambion®). 0.5 μg RNA/reaction was reverse transcribed using qScript cDNA supermix (QuantaBIO). Real Time RT-PCR was performed using TaqMan™ Universal PCRmastermix (Applied Biosystems™). CT-values were normalized to thehousekeeping gene GAPDH using the ΔΔCT-method. Primers are listedin Table 2.3.7. Fluorescent immunocytochemistryTo confirm true pluripotency capability of the derived iPSCs, a threeA.J. Duarte, et al. Stem Cell Research 41 (2019) 1015952germ layer test was conducted using Human Pluripotent Stem CellFunctional Identification Kit (R&D Systems®), to differentiate into en-doderm and ectoderm. To differentiate into mesoderm, a WNT pathwayactivator, CHIR99021 supplement (Stemcell™ Technologies) was used.The Base Media Supplement (50X) from the Stem Cell FunctionalIdentification Kit (R&D Systems®) was used in all cases. The Stem CellFig. 1. Characterisation of induced pluripotent stem cell line (INSAi001-A) from A Gaucher type 3 patient.A.J. Duarte, et al. Stem Cell Research 41 (2019) 1015953Functional Identification Kit (R&D Systems®) also contained antibodies,against Otx2, Brachyury and SOX17 (ectoderm, mesoderm and en-doderm markers, respectively). In brief, seeded iPSCs were fixed in 4%paraformaldehyde (Sigma-Aldrich) for 20 min and washed with PBS.Subsequently, cells were permeabilized with 0.25% triton X-100(Sigma-Aldrich) for 10 min, incubated with PBST with 1% BSA (Sigma-Aldrich) for 30 min and stained by standard immunofluorescence pro-cedures. Cells were analysed on DM4000 M fluorescence microscope(Leica). Antibodies are listed in Table 2.AcknowledgmentsThis work was carried out at the Department of Human Genetics ofINSA; financial support was received exclusively from the PortugueseFoundation of Science and Technology(FCT) project PTDC/BIM-MEC/4762/2014 (PI-O.A.) and R.S. is the recipient of an FCT Grant fromproject PTDC/BIM-MEC/4762/2014 (MCTES). The authors thankHildeberto Correia (Department of Human Genetics in Lisbon), for thekaryotype analysis; José Ferrão (Department of Human Genetics inLisbon), for the STR analysis; the collaboration of the central coreservices of Department of Human Genetics in Lisbon is acknowledge aswell as Meghan Quint for assistance with English language. The workwas supported by UIDB/00211/2020 with funding from FCT/MCTESthrough national funds.Supplementary materialsSupplementary material associated with this article can be found, inthe online version, at doi:10.1016/j.scr.2019.101595.ReferencesFilocamo, M., Mazzotti, R., Corsolini, F., Stroppiano, M., Stroppiana, G., Grossi, S., Lualdi,S., Tappino, B., Lanza, F., Galotto, S., Biancheri, R., 2014. Cell line and DNA biobankfrom patients affected by genetic diseases. Open J. Bioresources 1, e2.Filocamo, M., Mazzotti, R., Stroppiano, M., Seri, M., Giona, F., Parenti, G., Regis, S.,Corsolini, F., Zoboli, S., Gatti, R., 2002. Analysis of the glucocerebrosidase gene andmutation profile in 144 Italian gaucher patients. Hum. Mutat. 20 (3), 234–235.Ida, H., Rennert, O.M., Kawame, H., Maekawa, K., Eto, Y., 1997. Mutation prevalenceamong 47 unrelated Japanese patients with Gaucher disease: identification of fournovel mutations. J. Inherit. Metab. Dis 20, 67–73.Table 1Characterization and validation.Classification Test Result DataMorphology Photography (clear field microscopy) Visual inspection was normal Fig. 1 panel APhenotype Qualitative analysis (Immunofluorescence) Positive for NANOG, SOX2, OCT4 and TRA–1–60 (with DAPI) Fig. 1 panel BQuantitative analysis (RT-qPCR) Expression of OCT4 Fig. 1 panel CGenotype Karyotype (G-banding) and resolution 46XY, Resolution 450–500 Fig. 1 panel DIdentity STR analysis DNA Profiling Performed Supplementary fileMutation analysis Sequencing Compound heterozygous: p.L444P (rs421016) and p.F213I(rs381737)Fig. 1 panel EMicrobiology andvirologyPanRac AppliChem PCR Mycoplasma Test Kit(A3744)Mycoplasma testing: Negative Not shown but available withauthorDifferentiation potential Directed differentiation (Immunofluorescence) andembryoid body formationFormation of three germ layers: positive for Otx2 (ectodermmarker), Brachyury (mesoderm marker), and SOX17(endoderm marker)Fig. 1 panel FTable 2Reagent details.Antibodies used for immunocytochemistryAntibody Dilution Company Cat # and RRIDPluripotency markers Mouse anti-Nanog, clone 7F7.1, Alexa Fluor® 488 conjugate 1:100 Millipore Cat# MABD24, RRID:AB_11,203,826Mouse anti-Sox-2, clone 10H9.1, Cy3 conjugate 1:100 Millipore Cat# MAB4423, RRID:AB_11,205,572Mouse anti-Oct-4 (POU5f1), clone 7F9.2, Alexa Fluor® 488conjugate1:100 Millipore Cat# MAB4419, RRID:AB_1,977,399Mouse anti-TRA–1–60, clone TRA–1–60, Cy3 conjugate 1:100 Millipore Cat# MAB4360, RRID:AB_2,119,183Germ layer markers Goat Anti-Human Brachyury Polyclonal Antibody, unconjugated(Mesoderm)1:10 R and D Systems Cat# AF2085, RRID:AB_2,200,235Goat Anti-Human Sox17 Polyclonal Antibody, unconjugated(Endoderm)1:10 R and D Systems Cat# AF1924, RRID:AB_355,060Goat Anti-Human Otx2 Polyclonal Antibody, unconjugated(Ectoderm)1:10 R and D Systems Cat# AF1979, RRID:AB_2,157,172Secondary antibodies Donkey anti-Goat IgG (H+ +L) Cross-Adsorbed SecondaryAntibody, Alexa Fluor 4881:200 Thermo Fisher Scientific Cat# A-11,055,RRID:AB_2,534,102PrimersTarget TaqMan® assayPluripotency marker (qPCR) OCT-4 hs00999632_g1House-keeping gene (qPCR) GAPDH hs02786624_g1Target Forward/Reverse primer 5′–3′Targeted mutation sequencing Long Range GBA CGACTTTACAAACCTCCCTG/CCAGATCCTATCTGTGCTGGNested GBA exon 6 CTAATGGCTGAACCGGATG/GGAAGTGGAACTAGGTTGAGGNested GBA exon 10–11 GTGGGTGACTTCTTAGATGAGG/CTTTAGTCACAGACAGCGTGTGA.J. Duarte, et al. Stem Cell Research 41 (2019) 1015954

Sapientia (Univ. do Algarve)

Contents lists available at ScienceDirectStem Cell Researchjournal homepage: www.elsevier.com/locate/scrLab Resource: Single Cell LinesInduced pluripotent stem cell line (INSAi001-A) from a Gaucher disease type3 patient compound heterozygote for mutations in the GBA1 geneAna Joana Duartea,b,d, Diogo Ribeiroa,c,d, Renato Santosa, Luciana Moreiraa, José Bragançab,Olga Amarala,d,⁎a Departamento de Genética Humana, Unidade de Investigação e Desenvolvimento, Instituto Nacional de Saúde Dr Ricardo Jorge (INSA, IP), Rua Alexandre Herculano321, 4000-055 Porto, PortugalbUniversidade do Algarve, Campus Gambelas, Faro, Portugalc ICBAS, University of Porto, 4099-002 Porto, Portugald CECA, ICETA, University of Porto, 4099-002 Porto, PortugalA R T I C L E I N F OKeywords:Lysosomal glucocerebrosidaseInduced pluripotent stem cells (iPSCs)Cell modelsDisease modellingSendai virusFeeder-free cultureNon-integrative vectorGaucher type 3A B S T R A C TGaucher Disease (GD) type 3 is a neurological form of a multisystemic autosomal recessive disorder belonging tothe group of lysosomal storage diseases. Causal mutations in the glucocerebrosidase 1 (GBA1) commonly lead toabnormal protein and GD, heterozygosity is a genetic risk factor for Parkinson's disease. This work describes theuse of a non-integrative approach using Sendai Virus delivery to establish induced Pluripotent Stem Cells (iPSCs)from fibroblasts from a GD type 3 patient. Differentiation of iPSCs can be employed to generate a variety ofcomplex cell types with a high degree of genetic complexity that would otherwise be unattainable.Resource tableUnique stem cell line i-dentifierINSAi001-AAlternative name(s) ofstem cell lineGD3-1Institution INSAContact information ofdistributorOlga AmaralType of cell line Induced pluripotent stem cell line (iPSC)Origin Human (Istituto "Giannina Gaslini" Biobank)Additional origin info Age: 27 yearsSex: maleEthnicity if known: unknownCell Source Skin fibroblastsClonality ClonalMethod of reprogram-mingCytoTune™-iPS 2.0 SendaiReprogramming KitGenetic Modification YesType of Modification FamilialAssociated disease Gaucher DiseaseGene/locus GBA1 gene (Gene ID: 2629)/locus 1q22; Mutations incompound heterozygosity: p.L444P (rs421016) andp.F213I (rs381737)Method of modification Not applicableName of transgene or r-esistanceNot applicableInducible/constitutive s-ystemNot applicableDate archived/stock da-te2019/06/25Cell line repository/ba-nkThe cell line has not been deposited in a stem cell bank orrepository but is physically cryopreserved at INSA's facil-ities in CSPGF in Porto, Portugal.Ethical approval Original fibroblast line was obtained from a non-com-mercial provider, Gaslini Institute Biobank under GeneticBiobank Guidelines, Telethon - SIGU, Analysis 4/5, 2003.Italian Data Protection Authority (Garante Privacy),General Authorisation for the processing of genetic datano. 8/2016.1. Resource utilityLysosomal Storage Diseases (LSDs) may affect hard to reach cells,such as cardiac cells and neurons, which require invasive procedures toaccess the disease-target-tissue. The present work constitutes a firststage towards the final goal of differentiating iPSCs to generate specifichttps://doi.org/10.1016/j.scr.2019.101595Received 14 August 2019; Received in revised form 15 September 2019; Accepted 19 September 2019⁎ Corresponding author at: Department of Genetics, Unit of Research & Development, 4000 Porto, Portugal.E-mail addresses: ana.duarte@insa.min-saude.pt (A.J. Duarte), diogo.ribeiro@insa.min-saude.pt (D. Ribeiro), renato.santos@insa.min-saude.pt (R. Santos),luciana.moreira@insa.min-saude.pt (L. Moreira), jebraganca@ualg.pt (J. Bragança), olga.amaral@insa.min-saude.pt (O. Amaral).Stem Cell Research 41 (2019) 101595Available online 18 October 20191873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).Tcell types to aid model pathogenesis and testing of potential ther-apeutics. It represents a useful tool for optimization of therapeuticprotocols and identification of key factors regulating pathways in organinvolvement.2. Resource detailsThis work focuses on the development of iPSCs from fibroblastsusing non-integrative approaches in a cell line of one of the mostcommon sphingolipidoses, Gaucher disease (GD). GD is a LSD usuallycaused by mutations in the glucocerebrosidase 1 (GBA1, gene ID:2629),which lead to defective glucocerebrosidase (GlcCerase, EC 3.2.1.45).Clinically, GD encompasses a continuum of clinical findings with mul-tisystemic involvement, which for diagnosis purposes is divided in threemain categories. This work used type 3 GD fibroblasts (ORPHA:77,261,OMIM:231,000). GD type 3, with late onset neurological involvement,shares clinical features of type 1 and type 2. Over the years, geneticanalyses of Parkinson Disease (PD) patients have demonstrated thatGBA1 missense mutations constitute a relatively common risk factor fordeveloping PD. The continuum of clinical symptoms of GD now en-compasses a wide variety of neurologic symptoms in addition to themultisystemic features.The original manuscript regarding this cell line had a concomitantreport of two patients with similar GBA1 genotypes but different clin-ical forms. In such cases, it is particularly difficult to evaluate howmodifying factors can contribute to the different clinical disease ex-pression. The patient whose cells were used for generating INSAi001-Awas classified as type 3, while a younger patient, with similar genotype,was type 1 [Filocamo et al., 2002]. Such divergences in symptoms andclassifications make the use of iPSCs particular interesting for model-ling and pathogenesis studies. As stated in the original paper, the type 3patient was diagnosed at age five and splenectomyzed at age ten, re-gardless of enzyme therapy he later developed untreatable epilepsy[Filocamo et al., 2002]. Interestingly, both mutations exist as pseudo-gene sequence and they both exist in patients of Japanese origin Idaet al., 1997.Differentiation of iPSCs, INSAi001-A, can generate a variety ofcomplex cell types with a high degree of genetic complexity that wouldotherwise be unattainable and might help understand the pathogenesisof GD in such cases. An iPS cell line, INSAi001-A, was successfullygenerated from skin fibroblasts from a compound heterozygous patient.All results are summarized in Fig. 1. The fibroblasts were repro-grammed by co-expressing Yamanaka's factors, OCT3/4, SOX2, KLF4,and cMYC through the integration-free Sendai virus gene-deliverymethod on a feeder-free system with vitronectin (Fig. 1A). TheINSAi001-A cell line, showed endogenous expression of the plur-ipotency markers by positive immunofluorescence staining for NANOG,SOX2, OCT4 and TRA-1–60 (Fig. 1B1-4) further quantitative analysisalso showed elevated OCT4 by RT-qPCR (Fig. 1C). The resulting iPSCsINSAi001-A had a normal karyotype (Fig. 1D) and retained the GD-causing GBA1 mutations (Fig. 1E). Differentiation potential can be seenin Fig. 1F where formation potential of the three germ layers is shownby positive Immunofluorescence staining for mesoderm (Brachyury),endoderm (SOX17) and ectoderm (Otx2). The use of Sendai Virus (SeV)vectors under feeder free conditions proved to be effective in producingiPSCs that maintain the original genetic characteristics of the donorfibroblasts, as far as the extent of the examination as shown by thecausal mutations, gene and STR analysis.3. Materials and methods3.1. Biological sampleThe skin fibroblast cell line from GD-3 patient was obtained fromInstituto Giannina Gaslini Bioresource Bank in Geneva, Italy in com-pliance with the ethical recommendations issued by the Oviedoagreement of 1997 and the International Declaration on Human GeneticData of 2003 Filocamo et al., 2014. The GD cell line used was from atype 3 patient who bears a compound heterozygous genotype withp.L444P (rs421016) and p.F213I (rs381737).3.2. Fibroblast cultureCells were maintained in DMEM(1x)+GlutaMAX™ medium(Gibco™) supplemented with 10% foetal bovine serum in a cell in-cubator.3.3. Reprogramming of fibroblasts to iPSCsCellular reprograming of fibroblasts to iPSCs was carried out using anon-integrative approach. SeV reprogramming was carried out suc-cessfully on skin fibroblasts using CytoTune™-iPS 2.0 SendaiReprogramming Kit (Invitrogen™). As reprogramming matrixVitronectin (VTNeN from Gibco™) was used. By the 10th passage SeVwas no longer detected by PCR indicating that the experiment had beensuccessful and the iPSCs were free of viral footprint. Characterisationand validation is shown in Fig. 1 and Table 1.3.4. Cell culture and passageCells were cultured on 60mm plates coated with 1/100 Vitronectin(VTNeN) Recombinant Human Protein Truncated diluted in 1X DPBS.Incubation was at 37°C with 5% CO2 in a Refurbished Binder CB 150Air-Jacketed CO2 Incubator. Once high confluency is reached, themedium is removed, cells are washed with 1mL of 1X DPBS and treatedwith 1mL of 0,5 mM EDTA solution, after 4 min of incubation at roomtemperature, EDTA is removed. Cell passage is carried out by re-suspension in Gibco™ StemFlex™ Medium with 1% LonzaBioWhittaker™ PEN-STREP 5000 U Penicilin/mL and 10% Gibco™StemFlex™ Suplement (10X); 50 µL of cell suspension are added to newmatrix treated dishes in a 2mL volume of medium.3.5. Pluripotency characterisationAs determined by real-time quantitative analysis (Fig. 1C), expres-sion of the pluripotency gene OCT4 was upregulated in iPSCs comparedto the patient fibroblasts. As seen in Fig. 1B.1–4 qualitative analysis byimmunofluorescence with NANOG, SOX2, OCT4 and TRA-1–60 anti-bodies (indicated in Table 2), showed positive staining for all plur-ipotency markers confirming pluripotent status.3.6. Genetic characterisationGenotype was established in fibroblasts and in iPSCs and the mu-tations confirmed (Fig. 1E). See Table 2 for primers used. PCR productswere purified with ExoSAP™-IT (Applied Biosystems™), for Sanger se-quencing BigDye®Terminator v3.1 (Applied Biosystems™) was used.STR analysis used the AmpFeSTR® Identifier® (Applied Biosystems™).Karyotyping was performed on G-banded metaphase chromosomesusing standard procedures and at least five metaphases were examinedper sample. As seen in Fig. 1D, the Karyotype was normal (46, XY).Quantitative real time polymerase chain reaction (qRT-PCR) was car-ried out on RNA isolated using TRIzol Reagent (Ambion®). 0.5 μg RNA/reaction was reverse transcribed using qScript cDNA supermix (QuantaBIO). Real Time RT-PCR was performed using TaqMan™ Universal PCRmastermix (Applied Biosystems™). CT-values were normalized to thehousekeeping gene GAPDH using the ΔΔCT-method. Primers are listedin Table 2.3.7. Fluorescent immunocytochemistryTo confirm true pluripotency capability of the derived iPSCs, a threeA.J. Duarte, et al. Stem Cell Research 41 (2019) 1015952Fig. 1. Characterisation of induced pluripotent stem cell line (INSAi001-A) from A Gaucher type 3 patient.A.J. Duarte, et al. Stem Cell Research 41 (2019) 1015953germ layer test was conducted using Human Pluripotent Stem CellFunctional Identification Kit (R&D Systems®), to differentiate into en-doderm and ectoderm. To differentiate into mesoderm, a WNT pathwayactivator, CHIR99021 supplement (Stemcell™ Technologies) was used.The Base Media Supplement (50X) from the Stem Cell FunctionalIdentification Kit (R&D Systems®) was used in all cases. The Stem CellFunctional Identification Kit (R&D Systems®) also contained antibodies,against Otx2, Brachyury and SOX17 (ectoderm, mesoderm and en-doderm markers, respectively). In brief, seeded iPSCs were fixed in 4%paraformaldehyde (Sigma-Aldrich) for 20min and washed with PBS.Subsequently, cells were permeabilized with 0.25% triton X-100(Sigma-Aldrich) for 10min, incubated with PBST with 1% BSA (Sigma-Aldrich) for 30min and stained by standard immunofluorescence pro-cedures. Cells were analysed on DM4000 M fluorescence microscope(Leica). Antibodies are listed in Table 2.AcknowledgmentsThis work was carried out at the Department of Human Genetics ofINSA; financial support was received exclusively from the PortugueseFoundation of Science and Technology(FCT) project PTDC/BIM-MEC/4762/2014 (PI-O.A.) and R.S. is the recipient of an FCT Grant fromproject PTDC/BIM-MEC/4762/2014 (MCTES). The authors thankHildeberto Correia (Department of Human Genetics in Lisbon), for thekaryotype analysis; José Ferrão (Department of Human Genetics inLisbon), for the STR analysis; the collaboration of the central coreservices of Department of Human Genetics in Lisbon is acknowledge aswell as Meghan Quint for assistance with English language.Supplementary materialsSupplementary material associated with this article can be found, inthe online version, at doi:10.1016/j.scr.2019.101595.ReferencesFilocamo, M., Mazzotti, R., Corsolini, F., Stroppiano, M., Stroppiana, G., Grossi, S., Lualdi,S., Tappino, B., Lanza, F., Galotto, S., Biancheri, R., 2014. Cell line and DNA biobankfrom patients affected by genetic diseases. Open J. Bioresources 1, e2.Filocamo, M., Mazzotti, R., Stroppiano, M., Seri, M., Giona, F., Parenti, G., Regis, S.,Corsolini, F., Zoboli, S., Gatti, R., 2002. Analysis of the glucocerebrosidase gene andmutation profile in 144 Italian gaucher patients. Hum. Mutat. 20 (3), 234–235.Ida, H., Rennert, O.M., Kawame, H., Maekawa, K., Eto, Y., 1997. Mutation prevalenceamong 47 unrelated Japanese patients with Gaucher disease: identification of fournovel mutations. J. Inherit. Metab. Dis 20, 67–73.Table 1Characterization and validation.Classification Test Result DataMorphology Photography (clear field microscopy) Visual inspection was normal Fig. 1 panel APhenotype Qualitative analysis (Immunofluorescence) Positive for NANOG, SOX2, OCT4 and TRA–1–60 (with DAPI) Fig. 1 panel BQuantitative analysis (RT-qPCR) Expression of OCT4 Fig. 1 panel CGenotype Karyotype (G-banding) and resolution 46XY, Resolution 450–500 Fig. 1 panel DIdentity STR analysis DNA Profiling Performed Supplementary fileMutation analysis Sequencing Compound heterozygous: p.L444P (rs421016) and p.F213I(rs381737)Fig. 1 panel EMicrobiology andvirologyPanRac AppliChem PCR Mycoplasma Test Kit(A3744)Mycoplasma testing: Negative Not shown but available withauthorDifferentiation potential Directed differentiation (Immunofluorescence) andembryoid body formationFormation of three germ layers: positive for Otx2 (ectodermmarker), Brachyury (mesoderm marker), and SOX17(endoderm marker)Fig. 1 panel FTable 2Reagent details.Antibodies used for immunocytochemistryAntibody Dilution Company Cat # and RRIDPluripotency markers Mouse anti-Nanog, clone 7F7.1, Alexa Fluor® 488 conjugate 1:100 Millipore Cat# MABD24, RRID:AB_11,203,826Mouse anti-Sox-2, clone 10H9.1, Cy3 conjugate 1:100 Millipore Cat# MAB4423, RRID:AB_11,205,572Mouse anti-Oct-4 (POU5f1), clone 7F9.2, Alexa Fluor® 488conjugate1:100 Millipore Cat# MAB4419, RRID:AB_1,977,399Mouse anti-TRA–1–60, clone TRA–1–60, Cy3 conjugate 1:100 Millipore Cat# MAB4360, RRID:AB_2,119,183Germ layer markers Goat Anti-Human Brachyury Polyclonal Antibody, unconjugated(Mesoderm)1:10 R and D Systems Cat# AF2085, RRID:AB_2,200,235Goat Anti-Human Sox17 Polyclonal Antibody, unconjugated(Endoderm)1:10 R and D Systems Cat# AF1924, RRID:AB_355,060Goat Anti-Human Otx2 Polyclonal Antibody, unconjugated(Ectoderm)1:10 R and D Systems Cat# AF1979, RRID:AB_2,157,172Secondary antibodies Donkey anti-Goat IgG (H++L) Cross-Adsorbed SecondaryAntibody, Alexa Fluor 4881:200 Thermo Fisher Scientific Cat# A-11,055,RRID:AB_2,534,102PrimersTarget TaqMan® assayPluripotency marker (qPCR) OCT-4 hs00999632_g1House-keeping gene (qPCR) GAPDH hs02786624_g1Target Forward/Reverse primer 5′–3′Targeted mutation sequencing Long Range GBA CGACTTTACAAACCTCCCTG/CCAGATCCTATCTGTGCTGGNested GBA exon 6 CTAATGGCTGAACCGGATG/GGAAGTGGAACTAGGTTGAGGNested GBA exon 10–11 GTGGGTGACTTCTTAGATGAGG/CTTTAGTCACAGACAGCGTGTGA.J. Duarte, et al. Stem Cell Research 41 (2019) 1015954

https://sapientia.ualg.pt/bitstream/10400.1/13513/1/main.pdf

Induced pluripotent stem cell line (INSAi001-A) from a Gaucher disease type 3 patient compound heterozygote for mutations in the GBA1 gene

Abstract

Similar works

Full text

Available Versions

Scientific Repository of the National Health Institute Doutor Ricardo Jorge

Universidade do Algarve

Repositório Científico do Instituto Nacional de Saúde

Sapientia (Univ. do Algarve)